Nghiên cứu đặc điểm bệnh học và cơ chế đa kháng thuốc của hai loài vi khuẩn Edwardsiella ictaluri và Aeromonas hydrophila gây bệnh trên cá tra (Pangasianodon hypophthalmus) nuôi thâm canh ở Đồng bằng sông Cửu Long

346 0

Miễn phí

Tải về máy để xem đầy đủ hơn, bản xem trước là bản PDF

Tags: #đồ án#luận văn#Edwardsiella ictaluri#Pangasianodon hypophthalmus

Mô tả chi tiết

"NGHIÊN CỨU ĐẶC ĐIỂM BỆNH HỌC VÀ CƠ CHẾ ĐA KHÁNG THUỐC CỦA HAI LOÀI VI KHUẨN Edwardsiella ictaluri VÀ Aeromonas hydrophila GÂY BỆNH TRÊN CÁ TRA (Pangasianodon hypophthalmus) NUÔI THÂM CANH Ở ĐỒNG BẰNG SÔNG CỬU LONG"

Ý nghĩa thực tiễn của luận án Nghiên cứu đặc điểm bệnh học cảm nhiễm kép 2 loài vi khuẩn này là cơ sở và tiền đề cho các nghiên cứu tiếp theo trong việc tìm ra các giải pháp kiểm soát, quản lý dịch bệnh và cuối cùng là đưa ra các biện pháp phòng trị bệnh GTM và bệnh XH trên cá tra hiệu quả và an toàn. Đặc biệt, kết quả của nghiên cứu này là cơ sở khoa học để ứng dụng công nghệ cao cho việc sản xuất vaccine đa giá có thể phòng cùng lúc 2 loại vi khuẩn nguy hiểm này trên cá tra trong tương lai. Các thông tin về tính nhạy cảm kháng sinh và hiện trạng đa kháng thuốc của 2 loài vi khuẩn E. ictaluri và A. hydrophila gây bệnh trên cá tra giúp người nuôi cá có thể lựa chọn kháng sinh thích hợp trong việc điều trị bệnh do 2 loài vi khuẩn này 1 cách hiệu quả và sẽ tiết kiệm được chi phí điều trị, góp phần nâng cao thu nhập cho người nuôi

 

Nội dung

BỘ GIÁO DỤC VÀ ĐÀO TẠO TRƯỜNG ĐẠI HỌC CẦN THƠ QUÁCH VĂN CAO THI NGHIÊN CỨU ĐẶC ĐIỂM BỆNH HỌC VÀ CƠ CHẾ ĐA KHÁNG THUỐC CỦA HAI LOÀI VI KHUẨN Edwardsiella ictaluri VÀ Aeromonas hydrophila GÂY BỆNH TRÊN CÁ TRA (Pangasianodon hypophthalmus) NUÔI THÂM CANH Ở ĐỒNG BẰNG SÔNG CỬU LONG LUẬN ÁN TIẾN SĨ SINH HỌC CHUYÊN NGÀNH: VI SINH VẬT HỌC MÃ NGÀNH: 62 42 01 07 CẦN THƠ, 2017BỘ GIÁO DỤC VÀ ĐÀO TẠO TRƯỜNG ĐẠI HỌC CẦN THƠ QUÁCH VĂN CAO THI NGHIÊN CỨU ĐẶC ĐIỂM BỆNH HỌC VÀ CƠ CHẾ ĐA KHÁNG THUỐC CỦA HAI LOÀI VI KHUẨN Edwardsiella ictaluri VÀ Aeromonas hydrophila GÂY BỆNH TRÊN CÁ TRA (Pangasianodon hypophthalmus) NUÔI THÂM CANH Ở ĐỒNG BẰNG SÔNG CỬU LONG LUẬN ÁN TIẾN SĨ SINH HỌC CHUYÊN NGÀNH: VI SINH VẬT HỌC MÃ NGÀNH: 62 42 01 07 CÁN BỘ HƯỚNG DẪN KHOA HỌC PGS.TS. TỪ THANH DUNG CẦN THƠ, 2017i LỜI CAM ĐOAN Tôi xin cam đoan luận án “Nghiên cứu đặc điểm bệnh học và cơ chế đa kháng thuốc của hai loài vi khuẩn Edwardsiella ictaluri và Aeromonas hydrophila gây bệnh trên cá tra (Pangasianodon hypophthalmus) nuôi thâm canh ở Đồng bằng sông Cửu Long” là công trình nghiên cứu của tôi với sự hướng dẫn của PGS.TS. Từ Thanh Dung. Các số liệu và kết quả trình bày trong luận án này là trung thực và chưa từng được người khác công bố trong bất kỳ công trình nào khác. TÁC GIẢ LUẬN ÁN NCS. QUÁCH VĂN CAO THIii LỜI CÁM ƠN Tôi xin bày tỏ lòng biết ơn sâu sắc đến: Cô PGS.TS. Từ Thanh Dung đã dành nhiều thời gian, công sức và tận tình hướng dẫn tôi trong thời gian thực hiện luận án và theo học tại trường. Thầy PGS.TS. Trần Nhân Dũng đã động viên, giúp đỡ và tạo điều kiện thuận lợi nhất cho việc nghiên cứu và học tập tại Viện. Cô PGS.TS. Trần Thị Tuyết Hoa, Bộ môn Bệnh học Thủy sản, Khoa Thủy sản, trường Đại học Cần Thơ đã nhiệt tình hướng dẫn chuyên đề nghiên cứu sinh. Xin được gửi lời biết ơn sâu sắc đến Ban Giám hiệu trường Cao đẳng Cộng đồng Vĩnh Long; Ban lãnh đạo Viện NC&PT Công nghệ Sinh học và Khoa Thủy sản, trường Đại học Cần Thơ; quý Thầy/Cô và các Anh/Chị phòng Thanh tra và Pháp chế đã sắp xếp công việc cũng như tạo điều kiện thuận lợi về thời gian để tôi có thể hoàn thành chương trình học tập đúng tiến độ. Cảm ơn các hộ nuôi cá tra ở các tỉnh Đồng bằng sông Cửu Long đã cung cấp mẫu cá bệnh để phân lập vi khuẩn. Chân thành biết ơn anh Trần Văn Bé Năm (phòng Sinh học phân tử, Viện NC&PT Công nghệ Sinh học); em Nguyễn Bảo Trung và quý Thầy/Cô quản lý các phòng Thí nghiệm của Bộ môn Bệnh học Thủy sản, Khoa Thủy sản đã hỗ trợ và tạo điều kiện tốt nhất cho tôi hoàn thành luận án. Vô cùng biết ơn anh Trần Duy Phương (Công ty Pharmaq Việt Nam, chi nhánh Đồng Tháp) đã cung cấp cá tra giống sạch bệnh cho các thí nghiệm cảm nhiễm. Cảm ơn các Anh/Chị nghiên cứu sinh khóa 2012; sự hỗ trợ tích cực của các em học viên cao học: Huỳnh Thị Diễm Trang và Trần Tiến Lực và các em sinh viên: Đặng Phạm Hòa Hiệp, Trần Minh Khá, Hồ Văn To, Dương Thanh Quy, Lâm Cẩm Oanh, Bùi Thụy Hạnh Nguyên, Nguyễn Lâm Viên, Võ Trung Hiếu, Trần Quốc Hảo, Thị Mỹ Hạnh và Nguyễn Thị Hoa Đăng. Cuối cùng, sự thành công của luận án không thể không kể đến sự đóng góp không nhỏ của các thành viên trong gia đình, những người luôn ủng hộ, động viên và giúp tôi vượt qua rất nhiều khó khăn trong thời gian học tập. Chân thành cám ơn./. NCS. QUÁCH VĂN CAO THIiii TÓM TẮT Nghiên cứu được thực hiện với mục tiêu xác định các đặc điểm bệnh học cảm nhiễm kép (coinfection/super infection/concurrent infection/dual infection hay mixed infection) và cơ chế đa kháng thuốc của 2 loài vi khuẩn Edwardsiella ictaluri và Aeromonas hydrophila gây bệnh trên cá tra nuôi thâm canh ở Đồng bằng sông Cửu Long (ĐBSCL). Bằng các kỹ thuật sinh hóa truyền thống (bao gồm bộ kít API 20E) và sinh học phân tử (PCR và giải trình tự gen), đề tài đã phân lập và định danh được 141 chủng vi khuẩn (gồm 67 chủng vi khuẩn E. ictaluri và 74 chủng vi khuẩn A. hydrophila) từ các mẫu cá tra bệnh gan thận mủ (GTM) và bệnh xuất huyết (XH). Trong số các chủng vi khuẩn phân lập được thì có 22/67 (chiếm 32,84%) chủng E. ictaluri và 22/74 (chiếm 29,73%) chủng A. hydrophila có nguồn gốc từ cá tra nhiễm kép 2 loại bệnh này. Kết quả giải trình tự gen cho thấy các chủng vi khuẩn E. ictaluri và A. hydrophila phân lập có tỷ lệ tương đồng với các chủng vi khuẩn E. ictaluri và A. hydrophila trên ngân hàng GenBank dao động từ 99-100% và 98-100%. Kết quả thí nghiệm xác định độc lực và khả năng gây bệnh của các chủng vi khuẩn E. ictaluri và A. hydrophila với mật số tiêm vi khuẩn từ 102 đến 106 CFU/cá cho thấy cá tra sau khi cảm nhiễm có dấu hiệu biểu hiện bệnh đặc trưng của 2 loài vi khuẩn. Các đốm trắng nhỏ li ti xuất hiện trên các cơ quan như gan, thận và tỳ tạng của cá tra cảm nhiễm với vi khuẩn E. ictaluri; trong khi đó các dấu hiệu của bệnh XH do vi khuẩn A. hydrophila gồm mắt lồi, các đốm XH xuất hiện quanh các vây, miệng, hậu môn và trong xoang bụng cá bệnh thường có dịch màu hồng. Qua kết quả thí nghiệm cũng đã xác định được độc lực và liều gây chết LD50 của 4 chủng vi khuẩn E. ictaluri 1ED3, 3ED3, 8ED3 và 10ED3 lần lượt là 1,58x104, 1,23x105, 1,67x104 và 1,19x105 CFU/mL, trong khi độc lực và liều gây chết LD50 của 4 chủng vi khuẩn A. hydrophila 1A3, 2A3, 4A3 và 5A3 lần lượt là 1,47x104, 2,37x103, 1,29x103 và 1,52 x104 CFU/mL. Hai chủng 1ED3 và 4A3 có độc lực cao nhất trong thí nghiệm trên được chọn gây cảm nhiễm kép trên cá tra bằng phương pháp ngâm và tiêm. Kết quả thí nghiệm cho thấy việc cảm nhiễm kết hợp 2 chủng vi khuẩn này đã làm gia tăng độc lực gây bệnh của vi khuẩn. Bệnh bộc phát mạnh với tỷ lệ cá chết ở các nghiệm thức (NT) nhiễm kép (tỷ lệ cá chết tích lũy dao động từ 80% đến 93,33%) cao hơn có ý nghĩa thống kê (P< 0,05) so với phương pháp cảm nhiễm đơn. Thời gian vi khuẩn gây cá chết trong NT ngâm kép là 12 giờ, sớm hơn so với NT ngâm đơn 2 chủng 1ED3 và 4A3 lần lượt là 96 giờ và 36 giờ. Cá nhiễm kép trong nghiên cứu có các dấu hiệu bệnh tương tự với các dấu hiệu bệnh của cá nhiễm kép ngoài tự nhiên và chủ yếu là các dấu hiệu kết hợp của 2 loại bệnh này. Cá nhiễm kép thường có các dấu hiệu như mắt lồi, các đốm XH xuất hiện quanh các vây, miệng, hậu môn, dịch màu hồng trong xoang bụng và các đốm trắng nhỏ li ti xuất hiện trên các cơ quan như gan, thậniv và tỳ tạng. Ngoài ra, kết quả nhuộm Haematoxylin và Eosin (H&E) cho thấy có sự biến đổi cấu trúc tế bào và vùng mô của các cơ quan như gan, thận và tỳ tạng với các hiện tượng thường xuất hiện như sung huyết, XH và hoại tử mất cấu trúc. Tuy nhiên, cấu trúc tế bào và vùng mô ở các mẫu da-cơ và mang của cá nhiễm kép không hoặc ít bị biến đổi trong thời gian theo dõi thí nghiệm. Kết quả thực hiện kháng sinh đồ trên 67 chủng E. ictaluri và 74 chủng A. hydrophila cho thấy vi khuẩn E. ictaluri đã kháng hầu hết các kháng sinh với tỷ lệ cao như chloramphenicol (94,03%), florfenicol (94,03%), tetracycline (92,54%), streptomycin (74,63%), enrofloxacin (71,64%), gentamicin (46,27%) và norfloxacin (46,27%). Trong khi đó, vi khuẩn A. hydrophila kháng hoàn toàn và kháng cao với với các kháng sinh như ampicillin (100%), amoxicillin (100%), cefalexin (100%), tetracycline (90,54%), florfenicol (60,81%) và neomycin (54,05%). Đặc biệt, qua kết quả nghiên cứu cho thấy tất cả các chủng vi khuẩn E. ictaluri và A. hydrophila phân lập được đều thể hiện tính đa kháng với nhiều loại thuốc kháng sinh. Ngoài ra, kết quả luận án cũng cho thấy các chủng vi khuẩn E. ictaluri và A. hydrophila trong nghiên cứu thường xuyên tiếp xúc với kháng sinh trong môi trường nuôi cá tra với chỉ số đa kháng (MAR) ở các địa điểm thu mẫu đều lớn hơn 0,2. Nghiên cứu đã xác định các yếu tố di truyền liên quan đến cơ chế đa kháng thuốc của vi khuẩn như sự hiện diện của các integron nhóm 1 ở 2 loài vi khuẩn A. hydrophila và E. ictaluri với tỷ lệ lần lượt là 51,35% và 35,82%. Sử dụng kỹ thuật PCR và giải trình tự gen, luận án đã xác định nhiều vùng gen cassette mã hóa cho các enzyme dihydrofolate reductase, aminoglycoside adenyltransferase, aminoglycoside N(6')-acetyltransferase và β-lactamase kháng lại nhiều loại kháng sinh khác nhau ở 2 loài vi khuẩn A. hydrophila và E. ictaluri. Ngoài ra, sự hiện diện của các gen kháng tetracyline như tetA, tetB,, tetC, tetG, tetK và tetS đã được phát hiện ở 2 loài vi khuẩn A. hydrophila và E. ictaluri với tỷ lệ lần lượt là 82,5%, 8,75%, 31,25%, 33,75%, 8,75% và 7,5%; trong khi tần số xuất hiện các gen kháng florfenicol là 72,5% và 87,5%. Bên cạnh đó, kết quả nghiên cứu cho thấy vi khuẩn A. hydrophila và E. ictaluri có khả năng truyền gen kháng thuốc của chúng sang vi khuẩn E. coli trong môi trường ao nuôi cá tra. Tuy nhiên, giữa các chủng vi khuẩn A. hydrophila và E. ictaluri không có khả năng tiếp hợp và truyền gen kháng thuốc cho nhau. Từ khóa: Aeromonas hydrophila, cá tra, Edwardsiella ictaluri, integron, sự kháng thuốc.v SUMMARY This study was carried out to determine the experimentally pathological characteristics of coinfected fish and identify the molecular elements related to mechanism of multiple antimicrobial resistance in E. ictaluri and A. hydrophila cause diseases on intensively cultured striped catfish in the Mekong Delta. By using conventional biochemical tests (including the API 20E identification kit) and molecular biology techniques (PCR and gene sequencing), total of 141 strains of E. ictaluri and A. hydrophila from bacillary necrosis of Pangasius and hemorrhagic infected fish samples were isolated and identified. In which, there were 67 E. ictaluri and 74 A. hydrophila strains. Among these, there were 22/67 (32.84%) strains of E. ictaluri and 22/74 (29.73%) strains of A. hydrophila recovered from fish samples infected by both diseases. The gene sequencing results showed that the similarity of isolated bacterial sequence with the reference sequences in the GenBank ranged from 99 to 100% for E. ictaluri and from 98 to 100% for A. hydrophila strains. The virulence and pathogenicity of E. ictaluri and A. hydrophila strains were evaluated by intraperitoneal injection with 0.1 mL/fish at bacterial densities from 102 to 106 CFU/fish. The results showed that the moribund fish displayed typical clinical signs of single bacterial infection. Tiny white spots appeared on internal organs such as livers, kidneys and spleens of fish exposed to E. ictaluri. Meanwhile, the exophthalmic eyes and petechial spots appeared around the fins, mouth, anus and pinkish fluid in abdominal cavity were also recorded in hemorrhagic disease infected fish by A. hydrophila. The virulence and LD50 values of four strains of E. ictaluri (1ED3, 3ED3, 8ED3 and 10ED3) were 1.58x104, 1.23x105, 1.67x104, and 1.19x105 CFU/mL, respectively; while the virulence and LD50 values of four strains of A. hydrophila (1A3, 2A3, 4A3 and 5A3) were 1.47x104, 2.37x103, 1.29x103 and 1.52x104 CFU/mL, respectively. Two isolates (1ED3 and 4A3) with the highest virulence were chosen to conduct coinfection experiments by immersion and injection methods. The results indicated that concurrent infection of two bacterial species significantly increased the virulence of bacteria, compared to single bacterial infection. Severe disease outbreak with high mortality was also observed in dual-infection experiment (cumulative mortality percentage in concurrent infection test ranged from 80% to 93.33%), which were statistically significantly higher than single injection. The duration that caused fish mortality in the mixed infection test using immersion method was 12 hours which was shorter than single infection by separate immersion of 1ED3 (96 hours) and 4A3 (36 hours). The clinical and gross signs of experimentally co-infected fish were similar to those of natural co-infected fish. The typical signs of diseased fish included bulging eyes, petechial hemorrhages around the fins, mouth, anus,vi and pinkish fluid in abdominal cavity and tiny white spots in the internal organs such as livers, kidneys, and spleens. Additionally, Haematoxylin and Eosin (H&E) staining results also showed histopathological changes in tissues of organs such as the livers, kidneys and spleens with the phenomenon of congestion, hemorrhage and structural lose necrosis. However, the structural changes strongly took place in the liver, kidney and spleen tissues, whereas muscles-skins and gills of infected fish were significantly not or less affected through the whole experiment. The antimicrobial susceptibility testing results of 67 strains of E. ictaluri and 74 strains of A. hydrophila displayed that most of E. ictaluri strains were relatively highly resistant to chloramphenicol (94.03%), florfenicol (94.03%), tetracycline (92.54%), streptomycin (74.63%), enrofloxacin (71.64%), gentamicin (46.27%) and norfloxacin (46.27%). Meanwhile, A. hydrophila was relatively high resistant to tetracycline (90.54%), florfenicol (60.81%) and neomycin (54.05%) and completely resistant to ampicillin, amoxicillin, cefalexin and trimethoprim/sulfamethoxazole. Particularly, all of two bacterial strains in this study expressed multiple drug resistance. Besides, this research found that the bacterial strains frequently exposed to antibiotics had the MAR index (multiple antibiotic resistance) greater than 0.2 in all sampling sites. This study detected genetic elements related to the mechanisms of multi-drug resistance of E. ictaluri and A. hydrophila such as the presence of class 1 integrons with the ratio of 51.35% and 35.82%, respectively. Using PCR technique and gene sequencing, the study identified many different gene cassette regions encoding to dihydrofolate reductase, aminoglycoside adenyltransferase, aminoglycoside N(6')-acetyltransferase and β-lactamase enzymes resistant to different antibiotics in both bacterial species. Furthermore, this research found the presence of tetracycline resistance genes such as tetA, tetB, tetC, tetG, tetK and tetS of two bacterial species with the ratio of 82.5%, 8.75%, 31.25%, 33.75%, 8.75% and 7.5%, respectively; while the frequency of occurrence of florfenicol resistance gene in A. hydrophila and E. ictaluri was 72.5% and 87.5%, respectively. Besides, this study demonstrated that A. hydrophila and E. ictaluri strains were capable of transferring their resistance genes into E. coli collected from catfish aquatic environment. However, conjugation and transferability of drug resistance genes between A. hydrophila and E. ictaluri were not found in this research. Keywords: Aeromonas hydrophila, antibiotic resistance, Edwardsiella ictaluri, integron, striped catfish.vii MỤC LỤC Trang LỜI CAM ĐOAN ................................................................................................... i LỜI CÁM ƠN ........................................................................................................ ii TÓM TẮT ............................................................................................................. iii SUMMARY ............................................................................................................. v MỤC LỤC ............................................................................................................ vii DANH SÁCH BẢNG .............................................................................................. x DANH SÁCH HÌNH ............................................................................................. xi DANH MỤC CÁC TỪ VIẾT TẮT ................................................................... xiv Chương I. GIỚI THIỆU ........................................................................................ 1 1.1 Tính cấp thiết của luận án ................................................................................... 1 1.2 Mục tiêu của luận án .......................................................................................... 3 1.3 Nội dung nghiên cứu .......................................................................................... 3 1.4 Phạm vi nghiên cứu và giới hạn của luận án ...................................................... 3 1.5 Những đóng góp mới của luận án ...................................................................... 4 1.6 Ý nghĩa thực tiễn của luận án ............................................................................. 5 Chương II. LƯỢC KHẢO TÀI LIỆU .................................................................. 6 2.1 Tình hình sản xuất và tiêu thụ cá tra nuôi ở ĐBSCL ......................................... 6 2.2 Một số bệnh thường gặp trên cá tra nuôi thâm canh ở ĐBSCL ......................... 7 2.2.1 Bệnh do KST .......................................................................................... 7 2.2.2 Bệnh do tác nhân vi khuẩn ...................................................................... 8 2.2.3 Bệnh do vi nấm ..................................................................................... 18 2.2.4 Các bệnh không truyền nhiễm .............................................................. 19 2.3 Các nghiên cứu độc lực vi khuẩn nhiễm kép.................................................... 19 2.4 Các biện pháp kiểm soát bệnh do vi khuẩn trên cá tra nuôi ở ĐBSCL ............ 20 2.5 Kháng sinh và cơ chế tác động của kháng sinh ................................................ 21 2.5.1 Kháng sinh và sự kháng thuốc của vi khuẩn ........................................ 21 2.5.2 Cơ chế tác động của kháng sinh ........................................................... 22 2.5.3 Cơ chế kháng thuốc của vi khuẩn ......................................................... 23 2.6 Sự kháng thuốc của vi khuẩn trong NTTS ....................................................... 24 2.6.1 Sự kháng thuốc của vi khuẩn E. ictaluri ............................................... 25 2.6.2 Sự kháng thuốc của vi khuẩn A. hydrophila ......................................... 26 2.7 Hiện tượng và cơ chế đa kháng thuốc của vi khuẩn ......................................... 27 2.8 Các yếu tố di truyền vận động liên quan đến sự kháng thuốc của vi khuẩn .... 28 2.8.1 Plasmid .................................................................................................. 28 2.8.2 Các integron .......................................................................................... 29viii 2.9 Hiện tượng trao đổi gen kháng thuốc giữa các loài vi khuẩn trong tự nhiên ................................................................................................. 32 2.9.1 Các quá trình tiếp hợp và trao đổi gen kháng thuốc của vi khuẩn ........ 32 2.9.2 Các kết quả nghiên cứu liên quan đến khả năng truyền gen kháng thuốc giữa nhóm vi khuẩn gây bệnh ở ĐVTS và vi khuẩn E. coli ................ 33 2.10 Sự kháng tetracycline của vi khuẩn ................................................................ 35 2.10.1 Tổng quan về kháng sinh nhóm tetracycline ...................................... 35 2.10.2 Cơ chế hoạt động của kháng sinh nhóm tetracycline ......................... 35 2.10.3 Cơ chế kháng tetracycline của vi khuẩn ............................................. 35 2.11 Sự kháng florfenicol của vi khuẩn .................................................................. 37 2.11.1 Tổng quan về kháng sinh nhóm phenicol ........................................... 37 2.11.2 Cơ chế hoạt động của kháng sinh nhóm phenicol .............................. 38 2.11.3 Cơ chế kháng florfenicol của vi khuẩn ............................................... 38 Chương III. PHƯƠNG TIỆN VÀ PHƯƠNG PHÁP NGHIÊN CỨU ............. 39 3.1 Nội dung nghiên cứu ........................................................................................ 39 3.2 Phương tiện nghiên cứu .................................................................................... 39 3.2.1 Thời gian và địa điểm thí nghiệm ......................................................... 39 3.2.2 Dụng cụ và thiết bị thí nghiệm .............................................................. 39 3.2.3 Môi trường và hóa chất thí nghiệm ....................................................... 40 3.2.4 Vật liệu thí nghiệm ............................................................................... 42 3.3 Phương pháp nghiên cứu .................................................................................. 42 3.3.1 Địa điểm và phương pháp thu mẫu cá tra bệnh .................................... 42 3.3.2 Phân lập và định danh vi khuẩn E. ictaluri và A. hydrophila ............... 43 3.3.3 Xác định độc lực của các chủng vi khuẩn E. ictaluri và A. hydrophila ............................................................................................. 46 3.3.4 Nghiên cứu đặc điểm bệnh học cảm nhiễm kép 2 loài vi khuẩn E. ictaluri và A. hydrophila trên cá tra .......................................................... 48 3.3.5 Xác định tính nhạy cảm kháng sinh của các chủng vi khuẩn E. ictaluri và vi khuẩn A. hydrophila............................................................. 51 3.3.6 Xác định các đặc điểm phân tử liên quan đến sự đa kháng thuốc ở 2 loài vi khuẩn E. ictaluri và A. hydrophila..................................................53 3.3.7 Thành phần chung cho các phản ứng PCR ........................................... 59 3.3.8 Phương pháp phân tích và xử lý số liệu ................................................ 59 Chương IV. KẾT QUẢ VÀ THẢO LUẬN ........................................................ 60 4.1 Kết quả phân lập và định danh vi khuẩn .......................................................... 60 4.1.1 Kết quả phân lập và định danh vi khuẩn E. ictaluri ............................. 60 4.1.2 Kết quả phân lập và định danh vi khuẩn A. hydrophila ...................... 605 4.1.3 Kết quả phân lập và định danh vi khuẩn E. coli ................................... 71 4.2 Kết quả cảm nhiễm cá tra với vi khuẩn E. ictaluri và A. hydrophila ............... 72ix 4.2.1 Kết quả cảm nhiễm cá tra với các chủng vi khuẩn E. ictaluri .............. 72 4.2.2 Kết quả cảm nhiễm cá tra với các chủng vi khuẩn A. hydrophila ..... 728 4.3 Đặc điểm bệnh học cảm nhiễm kép 2 loài vi khuẩn A. hydrophila và E. ictaluri trên cá tra ................................................................................. 83 4.3.1 Kết quả tái phân lập và định danh vi khuẩn .......................................... 83 4.3.2 Dấu hiệu bệnh lý của cá bệnh ............................................................... 84 4.3.3 Khả năng gây bệnh khi gây cảm nhiễm kép 2 loài vi khuẩn ................ 86 4.3.4 Kết quả quan sát mẫu bằng phết kính tiêu bản tươi .............................. 90 4.3.5 Biến đổi cấu trúc mô của 1 số cơ quan cá bệnh .................................... 91 4. 4 Tính nhạy cảm kháng sinh của vi khuẩn E. ictaluri và A. hydrophila ............ 98 4.4.1 Sự kháng thuốc của vi khuẩn của vi khuẩn E. ictaluri và A. hydrophila ............................................................................................. 98 4.4.2 Sự đa kháng thuốc của vi khuẩn E. ictaluri và A. hydrophila ............ 104 4.4.3 Các kiểu hình đa kháng thuốc phổ biến của vi khuẩn E. ictaluri và A. hydrophila ........................................................................................... 106 4.4.4 Chỉ số đa kháng thuốc MAR của vi khuẩn E. ictaluri và A. hydrophila ........................................................................................... 107 4.5 Sự hiện diện các integron nhóm 1, 2 và 3 ở vi khuẩn E. ictaluri và A. hydrophila ........................................................................................... 109 4.5.1 Sự hiện diện các integron nhóm 1, 2 và 3 ........................................... 109 4.5.2 Đặc điểm vùng gen cassette của các chủng E. ictaluri và A. hydrophila dương tính với integron nhóm 1 .................................................................. 118 4.5.3 Khảo sát vùng 3’-conserved segment (CS) của các integron nhóm 1 ........................................................................................... 123 4.6 Sự hiện diện của các gen kháng florfenicol và tetracycline ở 2 loài vi khuẩn .............................................................................................. 126 4.6.1 Sự hiện diện của các gen kháng tetracycline ở vi khuẩn E. ictaluri và A. hydrophila ........................................................................................... 126 4.6.2 Sự hiện diện của các gen kháng florfenicol ở vi khuẩn E. ictaluri và A. hydrophila ........................................................................................... 135 4.7 Sự hiện diện của các plasmid ở vi khuẩn E. ictaluri và A. hydrophila .......... 136 4.7.1 Sự hiện diện của các plasmid ở vi khuẩn E. ictaluri .......................... 137 4.7.2 Sự hiện diện của các plasmid ở vi khuẩn A. hydrophila ..................... 137 4.8 Kết quả thí nghiệm khảo sát khả năng tiếp hợp và trao đổi gen kháng thuốc của các vi khuẩn ...................................................................... 141 Chương V. KẾT LUẬN VÀ ĐỀ NGHỊ ............................................................ 145 5.1 Kết luận .......................................................................................................... 145 5.2 Đề nghị ........................................................................................................... 146 TÀI LIỆU THAM KHẢO .................................................................................. 147 PHỤ LỤC ............................................................................................................ 175x DANH SÁCH BẢNG Trang Bảng 2.1: Một số đặc điểm hình thái, sinh lý và sinh hóa của vi khuẩn E. ictaluri ......................................................................................................... 9 Bảng 2.2: Một số đặc điểm hình thái, sinh lý và sinh hóa của vi khuẩn A. hydrophila ................................................................................................. 13 Bảng 2.3: Ước tính lượng kháng sinh sử dụng trong NTTS ở các quốc gia trên thế giới .................................................................................................... 22 Bảng 2.4: Các gen kháng đáp ứng tetracycline ...................................................... 37 Bảng 3.1: Thông tin các chủng vi khuẩn E. ictaluri và A. hydrophila được chọn thí nghiệm cảm nhiễm. ................................................................. 47 Bảng 3.2: Trình tự các cặp mồi dùng để phát hiện các integron nhóm 1, 2 và 3 ... 57 Bảng 3.3: Các đoạn mồi và điều kiện phản ứng PCR xác định các gen kháng tetracycline và florfenicol ở vi khuẩn E. ictaluri và A. hydrophila ............. 578 Bảng 3.4: Thành phần các hóa chất chung để thực hiện phản ứng PCR ................ 59 Bảng 4.1: Số chủng vi khuẩn E. ictaluri phân lập từ cá tra bệnh GTM hoặc cá nhiễm kép bệnh XH và GTM ở 1 số tỉnh ĐBSCL ........................... 60 Bảng 4.2: Kết quả kiểm tra các đặc điểm về hình thái, sinh hóa và định danh vi khuẩn E. ictaluri bằng bộ kít API 20E ...................................................... 64 Bảng 4.3: Số chủng vi khuẩn A. hydrophila phân lập từ cá tra bệnh XH hoặc cá nhiễm kép 2 bệnh XH và GTM ở 1 số tỉnh ĐBSCL ........................ 66 Bảng 4.4: Kết quả kiểm tra các đặc điểm về hình thái, sinh hóa và định danh vi khuẩn A. hydrophila phân lập được ........................................................... 69 Bảng 4.5: Giá trị LD50 của các chủng E. ictaluri cảm nhiễm trên cá tra ................ 77 Bảng 4.6: Giá trị LD50 của các chủng vi khuẩn A. hydrophila cảm nhiễm trên cá tra........................................................................................................ 81 Bảng 4.7: Số lượng cá chết tích lũy và kết quả phân lập vi khuẩn trong thí nghiệm cảm nhiễm kép bằng phương pháp ngâm và tiêm ......................................... 83 Bảng 4.8: Các kiểu hình đa kháng phổ biến của vi khuẩn E. ictaluri .................. 107 Bảng 4.9: Các kiểu hình đa kháng phổ biến của vi khuẩn A. hydrophila ............ 107 Bảng 4.10: Chỉ số đa kháng MAR của vi khuẩn E. ictaluri và A. hydrophila ở 1 số tỉnh ĐBSCL ....................................................................................... 108 Bảng 4.11: Sự hiện diện các integron nhóm 1 và kiểu hình kháng thuốc của vi khuẩn E. ictaluri ................................................................................ 112 Bảng 4.12: Sự hiện diện các integron nhóm 1 và kiểu hình kháng thuốc của vi khuẩn của vi khuẩn A. hydrophila ..................................................... 113 Bảng 4.13: Kết quả so sánh trình tự các vùng gen cassette của 2 loài vi khuẩn trên ngân hàng NCBI .................................................................... 120 Bảng 4.14: Sự hiện diện các gen kháng florfenicol và tetracycline ở các chủng vi khuẩn E. ictaluri và A. hydrophila. ........................................ 129 Bảng 4.15: Số lượng và kích thước plasmid ở các chủng vi khuẩn E. ictaluri .... 138 Bảng 4.16: Số lượng và kích thước plasmid ở các chủng vi khuẩn A. hydrophila ............................................................................................... 140 Bảng 4.17: Kiểu hình kháng thuốc của vi khuẩn nhận gen kháng thuốc sau khi tiếp hợp ............................................................................................ 143xi DANH SÁCH HÌNH Trang Hình 2.1: Sản lượng và kim ngạch xuất khẩu cá tra của ĐBSCL giai đoạn 1997-2014 ........................................................................................ 7 Hình 2.2: Các loại bệnh phổ biến trên cá tra nuôi ở ĐBSCL ................................... 8 Hình 2.3: Sơ đồ minh họa quá trình xâm nhiễm của vi khuẩn Aeromonas vào vật chủ qua vết thương ............................................................................ 16 Hình 2.4: Các nhóm kháng sinh và cơ chế tác động của chúng lên tế bào vi khuẩn .......................................................................................................... 23 Hình 2.5: Cơ chế đề kháng tự nhiên của vi khuẩn ................................................. 24 Hình 2.6: Cơ chế kháng thuốc của vi khuẩn........................................................... 25 Hình 2.7: Các hệ thống bơm đa kháng của vi khuẩn .............................................. 28 Hình 2.8: Sự trao đổi gen kháng thuốc qua plasmid .............................................. 29 Hình 2.9: Cấu trúc chung của các integron và cơ chế thu nhận các gen cassette của integron ......................................................................... 30 Hình 2.10: Cấu trúc chung của các integron nhóm 1 ............................................. 31 Hình 2.11: Các quá trình chuyển gen ngang ở vi khuẩn ........................................ 33 Hình 2.12: Cơ chế hoạt động của các kháng sinh thuộc nhóm tetracycline ........... 36 Hình 2.13: Các cơ chế kháng tetracycline ở vi khuẩn ............................................ 36 Hình 3.1: Sơ đồ minh họa các nội dung nghiên cứu chính của luận án ................. 39 Hình 3.2: Các địa điểm thu mẫu cá tra công nghiệp ở vùng ĐBSCL .................... 43 Hình 3.3: Sơ đồ minh họa phương pháp bố trí thí nghiệm cảm nhiễm đơn và cảm nhiễm kép các chủng vi khuẩn E. ictaluri và A. hydrophila trên cá tra. ........ 51 Hình 3.4: Sơ đồ minh họa vị trí khuếch đại 1 số gen trên các integron nhóm 1 và 2. ................................................................................................... 55 Hình 4.1: Đặc điểm hình thái, sinh lý và sinh hóa của vi khuẩn E. ictaluri ........... 61 Hình 4.2: Kết quả định danh vi khuẩn E. ictaluri phân lập được bằng bộ kít API 20E ..................................................................................... 652 Hình 4.3: Phổ điện di ADN của các chủng vi khuẩn E. ictaluri ............................ 65 Hình 4.4: Đặc điểm hình thái, sinh lý và sinh hóa của vi khuẩn A. hydrophila ..... 67 Hình 4.5: Hình 4.5: Kết quả định danh vi khuẩn A. hydrophila phân lập được bằng bộ kít API 20E ....................................................................................... 67 Hình 4.6: Phổ điện di ADN của các chủng vi khuẩn A. hydrophila ...................... 70 Hình 4.7: Các đặc điểm hình thái, sinh lý và sinh hóa của vi khuẩn E. coli phân lập được từ ruột và nước ao nuôi cá tra ở Đồng Tháp ................................... 72xii Hình 4.8: Kết quả tái phân lập và định danh vi khuẩn E. ictaluri sau khi cảm nhiễm trên cá tra. .................................................................................... 73 Hình 4.9: Dấu hiệu biểu hiện bệnh GTM của cá tra cảm nhiễm với vi khuẩn E. ictaluri chủng 1ED3. ................................................................................. 75 Hình 4.10: Tỷ lệ (%) cá tra chết tích lũy theo thời gian cảm nhiễm của 4 chủng vi khuẩn E. ictaluri. ....................................................................................... 76 Hình 4.11: Kết quả tái phân lập và định danh vi khuẩn A. hydrophila. ................. 79 Hình 4.12: Dấu hiệu biểu hiện bệnh XH của cá tra cảm nhiễm với vi khuẩn A. hydrophila chủng 4A3. .............................................................................. 80 Hình 4.13: Tỷ lệ (%) cá chết tích lũy theo thời gian của cá tra cảm nhiễm với các chủng vi khuẩn A. hydrophila. ................................................................ 81 Hình 4.14: Kết quả tái phân lập và định danh 2 loài vi khuẩn A. hydrophila và E. ictaluri sau khi cảm nhiễm kết hợp trên cá tra. .................................... 85 Hình 4.15: Các dấu hiệu bên ngoài của cá bệnh do nhiễm kép 2 chủng vi khuẩn A. hydrophila (4A3) và E. ictaluri (1ED3). ................................................... 85 Hình 4.16: Dấu hiệu bên trong cá cảm nhiễm kép 2 chủng vi khuẩn A. hydrophila (4A3) và E. ictaluri (1ED3). ................................................... 86 Hình 4.17: Tỷ lệ (%) cá chết tích lũy qua các ngày cảm nhiễm kết hợp 2 loài vi khuẩn E. ictaluri và A. hydrophila trên cá tra bằng phương pháp ngâm ... 87 Hình 4.18: Tỷ lệ cá (%) cá chết tích lũy qua các ngày cảm nhiễm kết hợp 2 loài vi khuẩn E. ictaluri và A. hydrophila trên cá tra bằng phương pháp tiêm..... 88 Hình 4.19: Các mẫu phết kính cá nhiễm kép 2 loài vi khuẩn E. ictaluri và A. hydrophila (Wright-Giemsa, 100X) ................................................... 932 Hình 4.20: Đặc điểm mô da-cơ cá tra nhiễm kép (H&E) ....................................... 93 Hình 4.21: Đặc điểm mô mang cá tra nhiễm kép (H&E) ....................................... 95 Hình 4.22: Đặc điểm mô thận cá tra nhiễm kép (H&E) ......................................... 96 Hình 4.23: Đặc điểm mô tỳ tạng cá tra nhiễm kép (H&E) ..................................... 97 Hình 4.24: Đặc điểm mô gan cá tra cá nhiễm kép (H&E). .................................... 98 Hình 4.25: Kết quả thực hiện kháng sinh đồ vi khuẩn E. ictaluri. ......................... 99 Hình 4.26: Tỷ lệ (%) các chủng vi khuẩn E. ictaluri nhạy cảm với các kháng sinh ......................................................................................... 99 Hình 4.27: Kết quả thực hiện kháng sinh đồ vi khuẩn A. hydrophila. ................. 100 Hình 4.28: Tỷ lệ (%) các chủng vi khuẩn A. hydrophila kháng, nhạy với các loại kháng sinh ................................................................................ 100 Hình 4.29: Tỷ lệ (%) kháng thuốc của 2 loài vi khuẩn E. ictaluri và A. hydrophila đối với các loại kháng sinh. ......................................................................... 101xiii Hình 4.30: Tỷ lệ (%) vi khuẩn E. ictaluri đa kháng thuốc. .................................. 105 Hình 4.31: Tỷ lệ (%) vi khuẩn A. hydrophila đa kháng thuốc. ............................ 105 Hình 4.32: Tỷ lệ (%) vi khuẩn đa kháng thuốc ở 2 loài vi khuẩn E. ictaluri và A. hydrophila. .......................................................................................... 106 Hình 4.33: So sánh chỉ số đa kháng MAR của vi khuẩn E. ictaluri và A. hydrophila ở 1 số tỉnh ĐBSCL. .......................................................... 109 Hình 4.34: Kết quả PCR xác định các gen IntI1 ở vi khuẩn A. hydrophila và E. ictaluri. ............................................................................................... 111 Hình 4.35: Tỷ lệ (%) xuất hiện các các integron nhóm 1 ở 2 loài vi khuẩn A. hydrophila và E. ictaluri. ........................................................................ 116 Hình 4.36: Vùng gen cassette của các chủng vi khuẩn E. ictaluri dương tính với các integron nhóm 1. ............................................................................. 118 Hình 4.37: Vùng gen cassette của các chủng vi khuẩn A. hydrophila dương tính với các integron nhóm 1. ............................................................................. 119 Hình 4.38: Gen qacEΔ1 của các chủng vi khuẩn A. hydrophila và E. ictaluri. ... 126 Hình 4.39: Gen sul1 của các chủng vi khuẩn A. hydrophila và E. ictaluri. ......... 126 Hình 4.40: Gen sul2 của các chủng vi khuẩn A. hydrophila và E. ictaluri. ......... 126 Hình 4.41: Gen sul3 của các chủng vi khuẩn A. hydrophila và E. ictaluri. ......... 126 Hình 4.42: Phổ điện di sản phẩm PCR của gen tetA ở các chủng vi khuẩn A. hydrophila và E. ictaluri. ........................................................................ 127 Hình 4.43: Phổ điện di sản phẩm PCR của gen tetB ở các chủng vi khuẩn A. hydrophila và E. ictaluri ......................................................................... 127 Hình 4.44: Phổ điện di sản phẩm PCR của gen tetC ở các chủng vi khuẩn A. hydrophila và E. ictaluri ......................................................................... 127 Hình 4.45: Phổ điện di sản phẩm PCR của gen tetG ở các chủng vi khuẩn A. hydrophila và E. ictaluri. ........................................................................ 128 Hình 4.46: Phổ điện di sản phẩm PCR của gen tetK ở các chủng vi khuẩn A. hydrophila và E. ictaluri. ........................................................................ 128 Hình 4.47: Phổ điện di sản phẩm PCR của gen tetS ở các chủng vi khuẩn A. hydrophila và E. ictaluri. ........................................................................ 128 Hình 4.48: Phổ điện di sản phẩm PCR của gen kháng florfenicol ở vi khuẩn ..... 136 Hình 4.49: Kết quả điện di plasmid các chủng vi khuẩn E. ictaluri. ................... 137 Hình 4.50: Kết quả điện di plasmid các chủng vi khuẩn A. hydrophila. .............. 139 Hình 4.51: Kết quả tiếp hợp giữa vi khuẩn A. hydrophila và E. ictaluri với vi khuẩn E. coli ...................................................................................... 142xiv DANH MỤC CÁC TỪ VIẾT TẮT A. hydrophila Aeromonas hydrophila ADH Arginine hidrolate ADN Acid deoxyribonucleic AMO Amoxicillin AMP Ampicillin AMY Amygdalin ARA Arabinose BHIA Brain heart infusion agar BHIB Brain heart infusion broth BKD Bacterial Kidney Disease BLAST Basic Local Alignment Search Tool BNN-PTNT Bộ Nông nghiệp và Phát triển Nông thôn BNP Bacillary Necrosis of Pangasius Bp Base pairs CFL Cefalexin CFU Colony forming unit (đơn vị hình thành khuẩn lạc) CIP Ciprofloxacin CIT Sodium citrate CLSI Clinical and Laboratory Standards Institute CTAB Cetyl trimethyl ammonium bromide CTX Cefotaxime ĐBSCL Đồng bằng sông Cửu Long ĐHCT Đại học Cần Thơ dNTPs Deoxyribonucleotide triphosphate DOX Doxycycline ĐVTS Động vật thủy sản E. coli Escherichia coli E. ictaluri Edwardsiella ictaluri EIM Edwardsiella ictaluri medium ENR Enrofloxacin ESC Enteric Septicemia of Catfish EtBr Ethidium bromide EUS Epizootic ulcerative syndrome (hội chứng/bệnh lở loét) FFC Florfenicol GEL Gelatin GEN Gentamicin GLU Glucose GTM Gan thận mủ H&E Haematoxyline và Eosin H2S Hydrogen sulfide CHL Chloramphenicol IND Indole INO Inositolxv Kbp Kilobase pairs KST Ký sinh trùng LD50 Lethal dose, 50% (liều gây chết 50) LDC Lysine decarboxylate MAN Mannitol MAR Multiple antibiotic resistance index (chỉ số đa kháng) MAS Motile aeromonad septicaemia (nhiễm trùng huyết do nhóm Aeromonas di động) MCK MacConkey agar MEL Melibiose MHA Muller-Hinton agar MIC Minimal inhibitory concentration (nồng độ ức chế tối thiểu) NB Nutrient broth NBF Neutral buffer formalin (dung dịch đệm formol trung tính) NCBI National Center for Biotechnology Information NEO Neomycin NOR Norfloxacin NT Nghiệm thức NTTS Nuôi trồng thủy sản ODC Ornithine decarboxylate ONPG Ortho-nitrophenyl galactosidase PCR Polymerase chain reaction (phản ứng PCR) RHA Rhamnose SAC Sucrose SDS Sodium dodecyl sulfate SEM Scanning Electron Microscope SOR Sorbitol STR Streptomycin SXT Trimethoprim/sulfamethoxazole TDA Tryptophane deaminase TET Tetracycline THIO Thioglycollate TSA Tryptic soy agar URE Urease VASEP Hiệp hội Chế biến và Xuất khẩu Thủy sản Việt Nam VP Voges-Proskauer XH Xuất huyết1 Chương I. GIỚI THIỆU 1.1 Tính cấp thiết của luận án Cá tra (Pangasianodon hypophthalmus) là 1 trong những loài cá da trơn nước ngọt có giá trị kinh tế cao được nuôi phổ biến ở ĐBSCL (Phan et al., 2009). Tuy nhiên, trong những năm gần đây, việc sản xuất và tiêu thụ cá tra đang phải đối mặt với nhiều khó khăn và thách thức do giá cả bấp bênh, thị trường xuất khẩu không ổn định và việc thâm canh hóa với mật số nuôi cao đã làm cho bệnh trên cá xảy ra thường xuyên hơn (Dung et al., 2008; Le and Cheong, 2010). Nhiều tác nhân gây bệnh (chủ yếu là các bệnh do vi khuẩn và ký sinh trùng (KST) xuất hiện trên cá tra nuôi ở ĐBSCL đã được báo cáo (Crumlish et al., 2002; Dung et al., 2008; Nguyễn Thị Thu Hằng và ctv., 2008; Ly et al., 2009; Nguyễn Thị Thu Hằng và Đặng Thị Hoàng Oanh, 2012; Từ Thanh Dung và ctv., 2012). Đặc biệt, các kết quả nghiên cứu gần đây đã xác định 2 loài vi khuẩn gây bệnh phổ biến và gây thiệt hại lớn cho nghề nuôi cá tra là bệnh GTM do vi khuẩn E. ictaluri (Crumlish et al., 2002; Từ Thanh Dung và ctv., 2004) và bệnh XH do vi khuẩn A. hydrophila (Ly et al., 2009; Crumlish et al., 2010). Đây là 2 bệnh có thể xảy ra trên cá tra ở tất cả các giai đoạn nuôi với tỷ lệ hao hụt có thể lên đến 90% (Từ Thanh Dung và ctv., 2015). Cho đến nay, kháng sinh vẫn là giải pháp chủ yếu để kiểm soát 2 bệnh này. Tuy nhiên, việc sử dụng quá nhiều thuốc kháng sinh (Nguyễn Chính, 2005; Nguyễn Quốc Thịnh và ctv., 2014; Phu et al., 2015) là 1 thách thức không nhỏ đang đặt ra cho nghề nuôi cá tra ở ĐBSCL do nhiều báo cáo cho thấy việc tồn dư của kháng sinh trong thực phẩm và vấn đề kháng thuốc của vi khuẩn (Cabello, 2006; Sarter et al., 2007; Akinbowale et al., 2007). Các nghiên cứu gần đây cho thấy 2 loài vi khuẩn E. ictaluri và A. hydrophila gây bệnh trên cá tra đã kháng với nhiều loại kháng sinh sử dụng trong nuôi trồng thủy sản (NTTS) (Crumlish et al., 2002; Dung et al., 2008; Từ Thanh Dung và ctv., 2010). Ngoài ra, vi khuẩn kháng thuốc có thể là nguồn để truyền và phát tán các gen kháng thuốc của chúng cho các loài vi khuẩn khác (van Elsas and Bailey, 2002; Heuer et al., 2009; Aminov, 2011; Marshall and Levy, 2011; Van Meervenne et al., 2012), đặc biệt là các loài vi khuẩn có tiềm năng, nguy cơ gây bệnh cho con người như vi khuẩn Escherichia coli, Aeromonas sp. và Pseudomonas sp. (DePaola et al., 1995; Dung et al., 2009; Nguyen et al., 2014). Điều này có thể ảnh hưởng trực tiếp hoặc gián tiếp đến sức khỏe người tiêu dùng.2 Bên cạnh đó, người nuôi còn sử dụng kết hợp nhiều loại kháng sinh (Phu et al., 2015) để điều trị bệnh trên cá tra dẫn đến hiện tượng đa kháng thuốc (multi-drug resistance/multiple antibiotic resistance) của vi khuẩn (kháng ít nhất 2 hoặc 3 loại kháng sinh trở lên) (McPhearson et al., 1991; DePaola et al., 1995; Sarter et al., 2007). Kết quả nghiên cứu của Dung et al. (2008) đã xác định 73% vi khuẩn E. ictaluri phân lập từ cá tra bệnh biểu hiện sự đa kháng thuốc. Trong khi đó, nghiên cứu của Phạm Thanh Hương và ctv. (2010) cho thấy có đến 96% vi khuẩn E. ictaluri và 23% vi khuẩn A. hydrophila thể hiện sự đa kháng. Hậu quả của trình trạng vi khuẩn đa kháng thuốc dẫn đến việc điều trị trở nên khó khăn và kém hiệu quả do liều lượng kháng sinh sử dụng tăng và thời gian điều trị kéo dài hơn (Phu et al., 2015). Đặc biệt, trong vài năm trở lại đây hiện tượng nhiễm kép xuất hiện rất phổ biến trên các động vật thủy sản (ĐVTS): vật chủ bị nhiễm 2 hay nhiều tác nhân gây bệnh khác nhau và mỗi tác nhân cùng ảnh hưởng có hại đến vật chủ (Bakaletz, 2004; Kotob et al., 2016). Trên cá tra nuôi ở ĐBSCL thì hiện tượng nhiễm kép 2 loài vi khuẩn E. ictaluri và A. hydrophila đã gây nhiều thiệt hại và tổn thất cho người nuôi do tỷ lệ cá chết cao đã được Crumlish and Dung (2002) ghi nhận. Kết quả nghiên cứu của Nusbaum and Morrison (2002) cho thấy cá nheo Mỹ (Ictalurus punctatus, Rafinesque) khi bị nhiễm vi khuẩn A. hydrophila chưa biểu hiện bệnh nhưng bệnh sẽ bộc phát mạnh khi cá nhiễm thêm vi khuẩn E. ictaluri. Hiện nay, việc chẩn đoán bệnh trên cá của người nuôi chủ yếu dựa vào các dấu hiệu biểu hiện lâm sàng thường hay xuất hiện hoặc gửi mẫu xét nghiệm. Điều này không thể đáp ứng được yêu cầu điều trị khi bệnh bùng phát do phải mất thời gian xét nghiệm hoặc do việc chẩn đoán sai tác nhân gây bệnh vì các dấu hiệu bệnh ngoài tự nhiên thường giống nhau có thể do 1 hoặc nhiều tác nhân cùng gây bệnh. Do đó, để ngành nuôi cá tra thâm canh ở ĐBSCL phát triển bền vững thì việc tìm ra các giải pháp kiểm soát, quản lý dịch bệnh và cuối cùng là đưa ra các biện pháp hiệu quả trong việc phòng và trị đối với 2 loài vi khuẩn E. ictaluri và A. hydrophila trên cá tra là rất cần thiết. Để thực hiện được điều đó, trước hết cần phải có những kiến thức về đặc điểm bệnh học do 2 loài vi khuẩn này cùng gây bệnh trên cá tra. Ngoài ra, cơ chế đa kháng thuốc của 2 loài vi khuẩn cũng cần được làm sáng tỏ nhằm quản lý và sử dụng kháng sinh hiệu quả và an toàn hơn. Cho đến nay, việc nghiên cứu các đặc điểm bệnh học nhiễm đơn và hiện tượng kháng thuốc của 2 loài vi khuẩn trên đã được thực hiện bởi nhiều tác giả (Ferguson et al., 2001; Đặng Thị Hoàng Oanh và Nguyễn Thanh Phương, 2009; Đặng Thuỵ Mai Thy và Đặng Thị Hoàng Oanh, 2010; Nguyễn Thiện Nam và ctv., 2010). Tuy nhiên, các thông tin về bệnh học3 cá tra nhiễm kép và các đặc điểm phân tử liên quan đến cơ chế đa kháng thuốc của 2 loài vi khuẩn trên chưa được nghiên cứu ở nước ta. Xuất phát từ thực tế trên, đề tài: “Nghiên cứu đặc điểm bệnh học và cơ chế đa kháng thuốc của hai loài vi khuẩn Edwardsiella ictaluri và Aeromonas hydrophila gây bệnh trên cá tra (Pangasianodon hypophthalmus) nuôi thâm canh ở Đồng bằng sông Cửu Long” được thực hiện. 1.2 Mục tiêu của luận án Xác định được 1 số đặc điểm bệnh học cảm nhiễm kép 2 loài vi khuẩn E. ictaluri và A. hydrophila gây bệnh trên cá tra nuôi thâm canh ở ĐBSCL nhằm làm cơ sở cho việc phát hiện và chẩn đoán bệnh. Xác định được cơ chế đa kháng thuốc của 2 loài vi khuẩn E. ictaluri và A. hydrophila nhằm mục đích kiểm soát, quản lý và sử dụng kháng sinh hiệu quả trên các ao nuôi cá tra ở ĐBSCL. 1.3 Nội dung nghiên cứu Để đạt được 2 mục tiêu trên, nghiên cứu đã thực hiện các nội dung sau: Phân lập và định danh vi khuẩn E. ictaluri và A. hydrophila gây bệnh GTM và XH trên cá tra nuôi thâm canh ở 1 số tỉnh ĐBSCL. Ngoài ra, đề tài còn phân lập các chủng vi khuẩn E. coli từ ruột và nước ao nuôi cá tra để khảo sát khả năng tiếp hợp và truyền gen kháng thuốc của 2 loài vi khuẩn E. ictaluri và A. hydrophila đối với vi khuẩn này. Nghiên cứu 1 số đặc điểm bệnh học (dấu hiệu biểu hiện bệnh, thời gian vi khuẩn gây bệnh, tỷ lệ cá chết và các đặc điểm mô bệnh học) cảm nhiễm kép 2 loài vi khuẩn E. ictaluri và A. hydrophila. Khảo sát tính nhạy cảm kháng sinh và hiện tượng đa kháng thuốc của các chủng vi khuẩn E. ictaluri và A. hydrophila phân lập từ cá tra bệnh. Nghiên cứu các đặc điểm phân tử liên quan đến cơ chế đa kháng thuốc của vi khuẩn như xác định sự hiện diện các integron nhóm 1, 2 và 3; sự hiện diện của các plasmid kháng thuốc và xác định 1 số gen kháng thuốc kháng sinh ở 2 loài vi khuẩn này. Khảo sát khả năng tiếp hợp và trao đổi gen kháng thuốc của 2 loài vi khuẩn E. ictaluri và A. hydrophila với vi khuẩn E. coli cũng như khả năng tiếp hợp và trao đổi gen kháng thuốc của 2 loài vi khuẩn này với nhau. 1.4 Phạm vi nghiên cứu và giới hạn của luận án Nghiên cứu chỉ phân lập các chủng vi khuẩn E. ictaluri và A. hydrophila từ các cơ quan gan, thận và tỳ tạng của cá tra bệnh GTM và XH hoặc cá nhiễm kép 2 bệnh này ở 1 số tỉnh có diện tích và sản lượng nuôi thâm canh lớn của4 vùng ĐBSCL mà không phân lập 2 loài vi khuẩn này từ môi trường ao nuôi cá tra (nước và bùn). Đề tài chỉ khảo sát độc lực của 4 chủng vi khuẩn E. ictaluri và 4 chủng vi khuẩn A. hydrophila đại diện cho các chủng vi khuẩn được phân lập ở các vùng nuôi cá tra khác nhau của ĐBSCL có số lượng cá nhiễm bệnh và tỷ lệ chết cao và chỉ thực hiện thí nghiệm cảm nhiễm kép trên 2 chủng có độc lực cao nhất. Thêm vào đó, luận án chỉ khảo sát sự hiện diện của các integron nhóm 1, 2 và 3 (liên quan đến kiểu hình kháng thuốc kháng sinh của vi khuẩn) mà không xác định các integron nhóm 4 và 5 do các intergron nhóm 4 và 5 không phổ biến như các integron nhóm 1, 2 và 3. Ngoài ra, nghiên cứu chỉ xác định sự hiện diện của các gen kháng tetracycline và florfenicol (đây là 2 trong số nhiều loại kháng sinh được sử dụng phổ biến trước đây cũng như ở thời điểm hiện tại trong các ao nuôi cá tra ở ĐBSCL). 1.5 Những đóng góp mới của luận án Luận án góp phần cung cấp các thông tin quan trọng về các đặc điểm bệnh học của việc nhiễm kép 2 loài vi khuẩn E. ictaluri và A. hydrophila trên cá tra nuôi ở ĐBSCL như thời gian vi khuẩn gây bệnh, tỷ lệ cá chết và các đặc điểm bệnh học ở mức đại thể và vi thể như các dấu hiệu biểu hiện bệnh (bên ngoài và bên trong) và các biến đổi về mặt mô bệnh học của 1 số cơ quan cá bệnh. Cung cấp các thông tin mới về tính nhạy cảm kháng sinh, đặc biệt là hiện trạng đa kháng thuốc của 2 loài vi khuẩn E. ictaluri và A. hydrophila gây bệnh trên cá tra nuôi ở ĐBSCL. Ngoài ra, luận án còn cung cấp các thông tin liên quan đến khả năng kháng thuốc kháng sinh của 2 loài vi khuẩn trên ở mức độ phân tử như xác định 1 số gen kháng tetracycline (tetA, tetB, tetC, tetG, tetK và tetS), florfenicol và sulfonamide (sul1, sul2 và sul3) mà các nghiên cứu trước đây chủ yếu tập trung vào kiểu hình kháng thuốc của vi khuẩn. Luận án góp phần làm sáng tỏ cơ chế đa kháng thuốc ở mức phân tử của 2 loài vi khuẩn E. ictaluri và A. hydrophila như xác định sự hiện diện của các plasmid kháng thuốc, các integron nhóm 1 cũng như xác định được các vùng gen cassette của vi khuẩn mã hóa cho các gen kháng thuốc khác nhau mà các nghiên cứu trước đây trong và ngoài nước chưa đề cập đến. Ngoài ra, kết quả nghiên cứu của luận án cho thấy 2 loài vi khuẩn E. ictaluri và A. hydrophila có khả năng tiếp hợp và truyền gen kháng thuốc cho vi khuẩn vi khuẩn E. coli thông qua các plasmid và integron. Tuy nhiên, giữa 2 loài vi khuẩn này thì không có khả năng tiếp hợp và trao đổi gen kháng thuốc với nhau.5 1.6 Ý nghĩa thực tiễn của luận án Nghiên cứu đặc điểm bệnh học cảm nhiễm kép 2 loài vi khuẩn này là cơ sở và tiền đề cho các nghiên cứu tiếp theo trong việc tìm ra các giải pháp kiểm soát, quản lý dịch bệnh và cuối cùng là đưa ra các biện pháp phòng trị bệnh GTM và bệnh XH trên cá tra hiệu quả và an toàn. Đặc biệt, kết quả của nghiên cứu này là cơ sở khoa học để ứng dụng công nghệ cao cho việc sản xuất vaccine đa giá có thể phòng cùng lúc 2 loại vi khuẩn nguy hiểm này trên cá tra trong tương lai. Các thông tin về tính nhạy cảm kháng sinh và hiện trạng đa kháng thuốc của 2 loài vi khuẩn E. ictaluri và A. hydrophila gây bệnh trên cá tra giúp người nuôi cá có thể lựa chọn kháng sinh thích hợp trong việc điều trị bệnh do 2 loài vi khuẩn này 1 cách hiệu quả và sẽ tiết kiệm được chi phí điều trị, góp phần nâng cao thu nhập cho người nuôi. Việc làm sáng tỏ bản chất phân tử của cơ chế đa kháng thuốc, hiện tượng kháng thuốc kháng sinh được truyền qua integron và plasmid của vi khuẩn, khả năng tiếp hợp và truyền gen kháng thuốc của 2 loài vi khuẩn này với vi khuẩn E. coli và giữa 2 loài vi khuẩn này với nhau sẽ giúp cho các nhà khoa học và cơ quan quản lý thuốc kháng sinh có các giải pháp tương lai để ngăn chặn và kiểm soát sự bùng phát mạnh mẽ hiện tượng kháng thuốc của vi khuẩn hiện nay nhằm hướng đến việc sản xuất cá tra an toàn và bền vững.6 Chương II. LƯỢC KHẢO TÀI LIỆU 2.1 Tình hình sản xuất và tiêu thụ cá tra nuôi ở ĐBSCL Nghề nuôi cá tra thương phẩm ở ĐBSCL bắt đầu xuất hiện từ những năm của thập niên 1950 với quy mô nhỏ và cá nuôi chủ yếu là dựa vào nguồn cá giống sẵn có trong tự nhiên (Nguyễn Thanh Phương và ctv., 2015). Tuy nhiên, từ cuối thập niên 1990 nghề nuôi cá tra đã phát triển vượt bậc do sự thành công trong việc sản xuất giống nhân tạo loài cá này cùng với các hệ thống và phương pháp nuôi đa dạng như từ nuôi đăng quầng, nuôi bè cho đến nuôi trong ao đất (Phan et al., 2009). Theo báo cáo của Phan et al. (2009) thì cá tra đạt sản lượng kỷ lục 683 nghìn tấn với giá trị xuất khẩu hơn 645 triệu đô la Mỹ vào năm 2007, đến năm 2010 thì sản lượng cá tra là 1.141.000 tấn và đạt kim ngạch xuất khẩu khoảng 1,4 tỉ đô la Mỹ (De Silva and Phuong, 2011). Trong 10 năm, từ năm 1997 đến 2007 được xem là giai đoạn hoàng kim của nghề nuôi cá tra với diện tích nuôi tăng 8 lần (từ 1.250 ha lên hơn 9.000 ha), sản lượng cá tra thương phẩm tăng 45 lần (từ 22.500 tấn lên hơn 1.200.000 tấn) và giá trị xuất khẩu tăng 50 lần (từ 19,7 triệu đô la Mỹ lên đến 979.036 triệu đô la Mỹ) (Phuong and Oanh, 2010). Hình 2.1 trình bày chi tiết sản lượng và kim ngạch xuất khẩu cá tra của ĐBSCL giai đoạn 1997-2014. Một trong những nguyên nhân làm diện tích và sản lượng cá tra ở ĐBSCL tăng cao là do chúng có khả năng thích nghi tốt với điều kiện môi trường, khí hậu khắc nghiệt và đặc biệt chúng là loài cá rất thích hợp sinh trưởng của vùng này (Đỗ Thị Thanh Hương và ctv., 2015). Ngoài ra, cá tra có thịt ngon và được ưa chuộng bởi người tiêu dùng của nhiều nước trên thế giới. Hiện tại, cá tra đã được nuôi thâm canh ở hầu hết các tỉnh ở ĐBSCL, trong đó An Giang, Đồng Tháp và Cần Thơ là các tỉnh có diện tích và sản lượng cá tra lớn nhất của vùng (Phan et al., 2009). Theo báo cáo thì phần lớn (trên 90%) sản lượng cá tra nuôi ở nước ta được chế biến và xuất khẩu (De Silva and Phuong, 2011). Hiện tại, cá tra nước ta đã được xuất khẩu sang hơn 180 quốc gia và vùng lãnh thổ trên thế giới (Nguyễn Thanh Phương và ctv., 2015). Trong những năm gần đây, việc sản xuất và tiêu thụ cá tra ở ĐBSCL mặc dù gặp nhiều khó khăn do giá nguyên liệu giảm nhưng diện tích và sản lượng cá tra vẫn duy trì ở mức cao, theo đó diện tích nuôi hiện nay khoảng 5.100 ha, sản lượng nuôi dao động từ 1,1-1,2 triệu tấn/năm và kim ngạch xuất khẩu đạt khoảng 1,8 tỉ đô la Mỹ /năm (Nguyễn Thanh Phương và ctv., 2015).7 Hình 2.1: Sản lượng và kim ngạch xuất khẩu cá tra của ĐBSCL giai đoạn 1997-2014 (Nguyễn Thanh Phương và ctv., 2015). 2.2 Một số bệnh thường gặp trên cá tra nuôi thâm canh ở ĐBSCL 2.2.1 Bệnh do KST Các bệnh do KST gây ra cũng thường hay xuất hiện trên cá tra nuôi ở ĐBSCL (Dung et al., 2008). Trên cá tra, KST thường hay ký sinh trên da, vây, mang, hốc mũi và xoang miệng của cá làm cho cá khó thở, bỏ ăn, sinh trưởng chậm và sức đề kháng giảm (Nguyễn Thị Thu Hằng và ctv., 2008). Ở giai đoạn cá bột và cá hương nếu nuôi mật độ dày, cơ thể cá còn non nên thường có cường độ và tỷ lệ cảm nhiễm cao và gây thiệt hại lớn cho sản xuất (Dung et al., 2008; Nguyễn Thị Thu Hằng và Đặng Thị Hoàng Oanh, 2012). Kết quả điều tra của Phan et al. (2009) cho thấy trên 80% cá tra nhiễm KST trong quá trình nuôi (Hình 2.2). Nghiên cứu của Nguyễn Thị Thu Hằng và ctv. (2008) đã xác định 19 loài KST (gồm 13 loài nội ký sinh và 6 loài ngoại ký sinh) xuất hiện trên các hệ thống nuôi cá tra nuôi thâm canh ở An Giang, trong khi đó kết quả điều tra về thành phần KST trên cá tra ở Đồng Tháp của Vũ Đặng Hạ Quyên và ctv. (2014) đã xác định 9 loài KST (gồm 7 loài nội ký sinh và 2 loài ngoại ký sinh). Nhìn chung, qua các kết quả nghiên cứu trên cho thấy các loại KST phổ biến được tìm thấy trên cá tra nuôi ở ĐBSCL gồm nhóm thích bào tử trùng Myxozoa (Myxobolus và Henneguya); vi bào tử trùng (Microsporidium); trùng bánh xe hay trùng mặt trời (Trichodina); trùng quả dưa (Ichthyophthirius), sán lá 16 móc (Dactylogyrus), trùng loa kèn (Apiosoma), trùng roi (Trypanosoma), trùng lông (Balantidium) và nhóm Epistylis (Dung et al., 2008; Nguyễn Thị Thu Hằng và Đặng Thị Hoàng Oanh, 2012; Phu et al., 2015). Gần đây, nghiên8 cứu của Nguyễn Thị Thu Hằng và Đặng Thị Hoàng Oanh (2016) cũng đã xác định vi bào tử trùng là tác nhân gây bệnh “gạo” trên cá tra. Hình 2.2: Các loại bệnh phổ biến trên cá tra nuôi ở ĐBSCL (Phan et al., 2009). 2.2.2 Bệnh do tác nhân vi khuẩn 2.2.2.1 Bệnh GTM do vi khuẩn E. ictaluri a. Phân loại và đặc điểm sinh học của vi khuẩn E. ictaluri Vi khuẩn E. ictaluri thuộc giống Edwardsiella, họ Enterbacteriaceae, bộ Enterobacteriales, lớp Gammaproteobacteria và ngành Proteobacteria (Abbott and Janda, 2006). Giống Edwardsiella lần đầu tiên được mô tả vào năm 1965 bởi Ewing et al. (1965). Trong giống này, ngoài vi khuẩn E. ictaluri còn có 2 loài khác là E. hoshinae và E. tarda (Sakazaki, 2001). Cho đến nay, nhiều báo cáo cho thấy 2 loài vi khuẩn E. ictaluri và E. tarda là các tác nhân gây bệnh nguy hiểm cho nhiều loài cá và ảnh hưởng nghiêm trọng cho ngành công nghiệp NTTS của nhiều nước trên thế giới (Crumlish et al., 2002; Yuasa et al., 2003; Yamada and Wakabayashi, 1999; Sakai et al., 2009; Shetty et al., 2014). Trong khi đó, vi khuẩn E. hoshinae được báo cáo là chỉ gây bệnh trên các loài bò sát và chim (Grimont et al., 1980). E. ictaluri thuộc nhóm vi khuẩn Gram âm, hình que, kích thước biến đổi từ 1,2-1,5 x 0,4-0,6 µm (Waltman et al., 1986; Ye et al., 2009). Vi khuẩn E. ictaluri có thể phát triển trên các môi trường dinh dưỡng khác nhau như môi trường MacConkey agar (MCK), tryptic soy agar (TSA), brain heart infusion agar (BHIA) và thioglycollate (THIO) (Shotts and Waltman, 1990). Vi khuẩn phát triển chậm trên các môi trường như TSA hay BHIA, sau 48 giờ cấy9 khuẩn lạc có dạng hình tròn, kích thước tương đối nhỏ (đường kính dao động từ 1-2 mm). Vi khuẩn có khả năng di động yếu, không sinh bào tử, yếm khí tùy tiện, lên men trong môi trường glucose, phản ứng catalase dương tính, âm tính trong phản ứng oxidase (Bảng 2.1). Chúng phát triển tốt ở 28oC và tăng trưởng chậm hoặc không tăng trưởng ở 37oC (Hawke et al., 1981; Waltman et al., 1986). Nhìn chung, vi khuẩn E. ictaluri có 1 số đặc điểm sinh hóa giống với vi khuẩn E. tarda. Tuy nhiên, vi khuẩn E. ictaluri cho phản ứng indole và H2S âm tính, trong khi vi khuẩn E. tarda cho phản ứng dương tính với indole và H2S (Abbott and Janda, 2006). Bảng 2.1: Một số đặc điểm hình thái, sinh lý và sinh hóa của vi khuẩn E. ictaluri TT Chỉ tiêu Đặc điểm* TT Chỉ tiêu Đặc điểm* 1 Gram - 11 Nitrate + 2 Hình dạng Que 12 Phản ứng VP - 3 Di động + 13 Thủy phân gelatin - 4 Oxidase - 14 Sinh indole - 5 Catalase + 15 Sinh H2S - 6 Phản ứng O/F +/+ 16 Glucose + 7 Arginine - 17 Xylose - 8 Lysine + 18 Arabinose - 9 Ornithine + 19 Sucrose - 10 Citrate - 20 Manitol - -: âm tính; +: dương tính; O/F (oxidation/fermentation): phản ứng oxid hóa và lên men đường glucose; VP: Voges-Proskauer (phản ứng sinh acetoin); * được tổng hợp từ Hawke et al. (1981) và Waltman et al. (1986). b. Phổ loài cảm nhiễm của vi khuẩn E. ictaluri Vi khuẩn E. ictaluri lần đầu tiên được phân lập bởi Hawke vào năm 1979 trên cá nheo Mỹ nhiễm bệnh ESC (Enteric Septicemia of Catfish: nhiễm trùng máu” (Hawke, 1979). Tuy nhiên, đến năm 1981 tác nhân gây bệnh này mới được định danh là vi khuẩn E. ictaluri (Hawke et al., 1981). Bệnh ESC ảnh hưởng trên 60% các trại nuôi và hàng năm thiệt hại cho ngành công nghiệp nuôi cá da trơn ở Mỹ hàng chục triệu đô la Mỹ (Wagner et al., 2002; Shoemaker et al., 2009). Trên cá tra, bệnh GTM hay bệnh BNP (Bacillary Necrosis of Pangasius) do vi khuẩn E. ictaluri còn được gọi là bệnh mủ gan, bệnh trắng gan hay bệnh ung thư gan. Vi khuẩn E. ictaluri chủ yếu xuất hiện trên cá tra (thỉnh thoảng xuất hiện trên cá basa) và gây chết cá với tỷ lệ rất cao (Crumlish et al., 2002; Nguyễn Quốc Thịnh và ctv., 2004; Từ Thanh Dung và ctv., 2015), đặc biệt bệnh gây hao hụt lớn ở giai đoạn cá giống (tỷ lệ chết có thể lên đến 90%) và trên cá tra nuôi thương phẩm (tỷ lệ chết có thể lên đến 50%) (Nguyễn Hữu Thịnh và Trương Thanh Loan, 2007). Theo Phan et al. (2009) thì bệnh xuất hiện trên tất cả các giai đoạn phát triển của cá, thường10 bùng phát mạnh mẽ vào mùa lũ và cao điểm vào tháng 6 và 7 (Hình 2.2). Tuy nhiên, trong những năm gần đây thì bệnh này xuất hiện trên cá tra hầu như quanh năm. Trong 1 vụ nuôi, bệnh GTM có thể xuất hiện từ 3-5 lần (Từ Thanh Dung và ctv., 2015). Cho đến nay, ngoài cá nheo và cá tra Việt thì vi khuẩn E. ictaluri được báo cáo là xâm nhiễm và gây bệnh trên nhiều loài cá da trơn khác như cá nheo nâu (Silurus glanis) ở Châu Âu và Mỹ (Hawke et al., 1981; Plumb and Hilge, 1987; Iwanowicz et al., 2006), cá nheo trắng (Ameiurus catus) ở Mỹ (Hawke et al., 1981), cá trê trắng (Clarius batrachus) ở Thái Lan (Kasornchandra, 1987), cá Noturus gyrinus ở Mỹ (Klesius et al., 2003), cá tra ở Indonesia và Thái Lan (Yuasa et al., 2003; Dong et al., 2015). Gần đây, vi khuẩn E. ictaluri được báo cáo là xuất hiện và gây bệnh đốm đỏ (red sores) trên cá Bò đen (Pelteobagrus fulvidraco) (Ye et al., 2009; Liu et al., 2010; Yi et al., 2010) và cá Silurus soldatovi meridionalis ở Trung Quốc (Geng and Wang, 2013), cá lai (hybrid catfish) của loài Clarias macrocephalus (Gunther) và Clarias gariepinus (Burchell) ở Thái Lan (Suanyuk et al., 2014). Ngoài ra, các loài cá khác cũng được ghi nhận sự xâm nhiễm của vi khuẩn này như cá hồi vân (Oncorhynchus myliss) ở Thổ Nhĩ Kỳ (Keskin et al., 2004), cá ayu (Plecoglossus altivelis) ở Nhật (Sakai et al., 2008; Hassan et al., 2012), cá rô phi vằn (Oreochromis niloticus) ở Basseterre, St. Kitts (Soto et al., 2012) và cá ngựa vằn (Danio rerio) ở Mỹ (Petrie-Hansen, 2007; Hawke et al., 2013). c. Đường lây truyền và dấu hiệu bệnh do vi khuẩn E. ictaluri Nhiều nghiên cứu cho thấy vi khuẩn E. ictaluri có thể xâm nhiễm vào vật chủ qua nhiều con đường khác nhau. Nghiên cứu của Morrison and Plumb (1994) cho thấy mũi là con đường để vi khuẩn E. ictaluri xâm nhiễm vào cá, trong khi các nghiên cứu khác cho thấy vi khuẩn E. ictaluri xâm nhiễm vào cá qua mang và đường tiêu hóa (Miyazaki and Plumb, 1985; Shotts et al., 1986; Newton et al., 1989; Baldwin and Newton, 1993; Klesius, 1994; Nusbaum and Morrison, 1996). Bên cạnh đó, kết quả nghiên cứu gần đây của Dung et al. (2012) và Pirarat et al. (2016) cho thấy hệ tiêu hóa và mang có thể là đường xâm nhập của vi khuẩn E. ictaluri vào cơ thể cá tra. Mô tả về đặc điểm của cá bệnh ESC do vi khuẩn E. ictaluri trên cá nheo Mỹ đã được nhiều tác giả nghiên cứu. Nhìn chung, cá bệnh ESC thường xuất hiện các vết loét đỏ và trắng nhỏ, các đốm xuất huyết (petechial haemorrhage) quanh miệng, các vây, mặt bụng hoặc mặt bên (ventral and lateral surface), mang nhạt và trương phình, mắt lồi và bụng trương (Areechon and Plumb 1983; Jacrboe et al., 1984; Hawke et al., 1998). Cá bệnh ESC trên cá nheo thường có 2 dạng: cấp tính (acute form) và mãn tính (chronic form) (Newton11 et al., 1989). Ở dạng cấp tính, cá thường chết nhanh (2 ngày sau khi nhiễm vi khuẩn), tỷ lệ cá chết cao với các dấu hiệu bệnh gồm viêm ruột (enteritis) và nhiễm trùng huyết (septicemia), trong khi viêm não và màng não (meningoencephalitis) với các vết thương ở đầu (được gọi là “hole in the head”) là đặc điểm bệnh ESC ở dạng mãn tính (Miyazaki and Plumb 1985; Shotts et al., 1986; Newton et al., 1989). Ở Việt Nam, bệnh GTM được ghi nhận xuất hiện trên cá tra nuôi ở ĐBSCL vào cuối năm 1998 (Ferguson et al., 2001; Crumlish et al., 2002). Cá bệnh có dấu hiệu bệnh lý bên ngoài là cá gầy và mắt hơi lồi. Trường hợp bệnh nặng cá bỏ ăn và bơi lờ đờ trên mặt nước (Dung et al., 2012; Pirarat et al., 2016). Tuy nhiên, các dấu hiệu bệnh bên ngoài của cá thường không rõ ràng (Dung et al., 2008). Khi giải phẩu bên trong cá xuất hiện nhiều đốm trắng đục kích cở 1-3 mm trên gan, thận và tỳ tạng (Ferguson et al., 2001). Ngoài ra, ở giai đoạn đầu mới nhiễm bệnh, những đốm trắng được ghi nhận là chỉ xuất hiện trên thận hoặc tỳ tạng của cá (Dung et al., 2008). d. Khả năng gây bệnh và độc lực của vi khuẩn E. ictaluri Khả năng gây bệnh và độc lực của vi khuẩn E. ictaluri đã được nhiều tác giả trên thế giới nghiên cứu. Nhìn chung, hầu hết các nghiên cứu đều cho thấy các chủng vi khuẩn khác nhau sẽ có khả năng gây bệnh và độc lực khác nhau. Nghiên cứu về độc lực của vi khuẩn E. ictaluri gây bệnh GTM trên cá tra của Đặng Thị Hoàng Oanh và Nguyễn Thanh Phương (2009) cho thấy độc lực của các chủng vi khuẩn thí nghiệm cao nhất là <102 CFU/mL và thấp nhất là 106 CFU/mL. Gần đây, thí nghiệm cảm nhiễm vi khuẩn E. ictaluri trên cá tra của Đặng Thuỵ Mai Thy và Đặng Thị Hoàng Oanh (2010) cũng cho thấy chủng E. ictaluri Ei1 gây chết cá với tỷ lệ cao nhất (100%) ở mật số <102 CFU/mL, trong khi đó chủng E. ictaluri Ei4 ở mật số 6,4x105 CFU/mL gây chết với tỷ lệ thấp nhất (53%). Bên cạnh đó, các nghiên cứu khác cho thấy thời gian và tỷ lệ cá chết đều khác nhau trên các loài cá khác nhau khi gây cảm nhiễm với vi khuẩn E. ictaluri. Chẳng hạn, thí nghiệm của Plumb and Sanchez (1983) cho thấy cá nheo chết 100% trong 10 ngày sau khi cảm nhiễm với vi khuẩn E. ictaluri ở mật số vi khuẩn là 1,5x103 CFU/mL. Baxa et al. (1990) gây cảm nhiễm vi khuẩn E. ictaluri với các loài cá khác nhau bằng phương pháp ngâm ở nồng độ 1x108 CFU/mL. Kết quả sau 14 ngày thí nghiệm cho thấy vi khuẩn đã gây chết cá nheo với tỷ lệ là 32%, cá hồi trắng là 75% và cá vược sọc là 5% nhưng vi khuẩn không gây chết ở cá tầm trắng. Tương tự, cá nheo khi ngâm với vi khuẩn E. ictaluri ở mật độ 1x 107 CFU/mL trong thời gian một giờ cho thấy12 sau 5-20 ngày thí nghiệm, cá bị chết với tỷ lệ là 28% (Klesius and Sealey, 1995). Gần đây, Crumlish et al. (2010) tiến hành cảm nhiễm trên cá tra bằng phương pháp tiêm và ngâm với vi khuẩn E. ictaluri ở nồng độ vi khuẩn lần lượt là 1x106 và 1x108 CFU/mL. Kết quả cho thấy sau 12 ngày thí nghiệm tỷ lệ cá chết ở phương pháp tiêm là 95%, còn ở phương pháp ngâm là 80%. e. Các biến đổi về mô học của cá nhiễm bệnh do vi khuẩn E. ictaluri Cho đến nay, các biến đổi về cấu trúc mô học khi nhiễm vi khuẩn E. ictaluri đã được mô tả và báo cáo trên 1 số loài cá. Nhìn chung, các nghiên cứu đều cho thấy hiện tượng hoại tử các nội quan là biến đổi xuất hiện phổ biến khi cá nhiễm vi khuẩn E. ictaluri (Jarboe et al., 1984; Miyazaki and Plumb, 1985; Crumlish et al., 2010; Từ Thanh Dung, 2011). Trên cá nheo Mỹ, kết quả nghiên cứu của Areechon and Plumb (1983) cho thấy gan, thận, tỳ tạng và tế bào tuyến tụy bị hoại tử khi cá được tiêm vi khuẩn E. ictaluri. Nghiên cứu của Sakai et al. (2008) cho thấy cấu trúc mô gan, thận và tỳ tạng của cá ayu (Plecoglossus altivelis) ở Nhật bị biến đổi khi nhiễm vi khuẩn E. ictaluri. Ngoài ra, kết quả nghiên cứu này còn cho thấy màng ngoài của tỳ tạng bị hoại tử và nhiều vùng tế bào gan của cá bị chết. Trên cá tra, các nghiên cứu về cấu trúc mô học khi bị bệnh GTM do vi khuẩn E. ictaluri cũng được thực hiện nhiều từ khi bệnh này xuất hiện trên cá tra ở nước ta (Ferguson et al., 2001; Từ Thanh Dung, 2011; Pirarat et al., 2016). Nghiên cứu của Nguyễn Quốc Thịnh và ctv. (2004) cho thấy nhiều thay đổi về cấu trúc, đặc biệt là gan, thận và tỳ tạng có hiện tượng sung huyết, XH và hoại tử xuất hiện ở các vùng chức năng của các cơ quan kể trên. Ngoài ra, ở cá bệnh có hiện tượng dính lại của các tia mang nhưng không tìm thấy các biến đổi ở cơ và tim của cá bệnh. Tuy nhiên, trong nghiên cứu của Ferguson et al. (2001) cho thấy ngoài hiện tượng hoại tử ở gan, thận và tỳ tạng thì vi khuẩn E. ictaluri còn gây hoại tử trên cơ của cá. Các đặc điểm về mô học cá tra nhiễm vi khuẩn E. ictaluri cũng được mô tả và báo cáo tương tự qua các nghiên cứu của Đặng Thị Hoàng Oanh và Nguyễn Thanh Phương (2009), Đặng Thụy Mai Thy và Đặng Thị Hoàng Oanh (2010). Nhìn chung, qua kết quả nghiên cứu của các tác giả này cho thấy khi bị nhiễm vi khuẩn E. ictaluri thì các cơ quan như gan, thận và tỳ tạng thường dễ bị thay đổi và các biểu hiện thường gặp là sung huyết, XH và hoại tử. Trong khi đó, các cơ quan như mang, da-cơ ít hay không bị biến đổi. 2.2.2.2 Bệnh XH do vi khuẩn A. hydrophila a. Phân loại và đặc điểm sinh học của vi khuẩn A. hydrophila Vi khuẩn A. hydrophila thuộc giống Aeromonas, họ Aeromonadaceae, bộ Aeromonadales, lớp Gamma proteobacteria và ngành Proteobacteria (Janda13 and Abbott, 2010). Cho đến nay, có ít nhất 26 loài trong giống này đã được báo cáo (Beaz-Hidalgo et al., 2013; http://www.bacterio.net). Các loài vi khuẩn trong giống Aeromonas được chia thành 2 nhóm: nhóm các loài Aeromonas ưa lạnh (psychrophilic) và nhóm các loài Aeromonas ưa nhiệt trung bình (mesophilic). Nhóm ưu lạnh phát triển tốt nhất ở 15-20oC hoặc ở nhiệt độ thấp hơn: 0-5oC (Aberoum and Jooyandeh, 2010), không có tiêm mao và không di động, phổ biến là loài A. salmonicida gây bệnh nhọt (furunculosis) và nhiễm trùng máu (septicaemia) trên nhiều loài cá, đặc biệt gây bệnh trên các loài cá hồi (Lee et al., 2002; Nomura et al., 2002; Lund and Mikkelsen, 2004; Kim et al., 2011b; Beaz-Hidalgo et al., 2013; Dallaire-Dufresne et al., 2014). Trong khi đó, các loài Aeromonas ưa nhiệt trung bình (phổ biến là các loài A. hydrophila, A. caviae và A. sorbia) có thể phát triển tốt nhất ở 35-37oC hoặc có khả năng phát triển nhiệt độ cao hơn (40-45oC) nhưng nhìn chung các loài vi khuẩn thuộc nhóm này sẽ không phát triển ở nhiệt độ dưới 10oC (Aberoum and Jooyandeh, 2010) và là các vi khuẩn có khả năng di động (Korbsrisate et al., 2002; Lai et al., 2007; Parker and Shaw, 2011). A. hydrophila thuộc nhóm vi khuẩn Gram âm, có hình que ngắn với kích thước dao động từ 0,8-1,0 x 1,0-3,5 μm (Austin and Austin, 2007). Vi khuẩn A. hydrophila thường phát triển rất nhanh trên các môi trường dinh dưỡng. Chúng phát triển tốt ở nhiệt độ 28-30oC. Sau 18-24 giờ cấy trên các môi trường TSA, BHIA hoặc môi trường GSP (Glutamate Starch Phenol Red Agar), khuẩn lạc vi khuẩn có dạng tròn, to (đường kính 2-3 mm), màu vàng kem (Austin and Austin, 2007; Phạm Thanh Hương, 2010). Vi khuẩn A. hydrophila có khả năng di động, yếm khí tuỳ tiện, phản ứng dương tính với oxidase, catalase, Voges-Proskauer, lysine, arginine và ornithine (Janda and Abbott, 2010) (Bảng 2.2). Chúng có khả năng lên men các môi trường đường và sinh khí từ glucose nhưng không có khả năng tạo khí H2S (Austin and Austin, 2007; Janda and Abbott, 2010). b. Phổ loài cảm nhiễm của vi khuẩn A. hydrophila Vi khuẩn A. hydrophila được xem là tác nhân gây bệnh cho nhiều động vật dưới nước và trên cạn (Janda and Abbott, 2010). Nhiều báo cáo cho thấy sự hiện diện của vi khuẩn gây bệnh này trên cá, lưỡng cư và bò sát (Vivas et al., 2004), đặc biệt là chúng còn gây bệnh cho con người (Janda and Abbott, 2010). Ngoài ra, vi khuẩn A. hydrophila còn được tìm thấy trên nhiều loại thực phẩm mà chúng sản sinh nhiều độc tố (toxin) gây độc như các exotoxin (haemolysin và enterotoxin), cytotoxin và các độc tố khác (Yucel et al., 2005; Daskalov, 2006). Cho đến nay, ngoài cá nheo Mỹ thì vi khuẩn A. hydrophila còn được phân lập trên 1 số loài cá da trơn khác như cá trê trắng (Clarias14 batrachus) (Ashiru et al., 2011) và cá trê phi (Clarias gariepinus) ở Malaysia (Laith and Najiah, 2013), cá Heteropneustes fossilis ở Bangladesh (Sarkar and Rashid, 2012). Ngoài ra, vi khuẩn A. hydrophila còn được tìm thấy trên các loài cá khác như cá rô phi vằn (Oreochromis niloticus) ở Ai Cập (Noor El Deen et al., 2014), cá rằm Puntius sp. ở Ấn Độ (Mohanty et al., 2008), cá Koi Carrassius auratus và cá chép (Cyprinus carpio) ở Ấn Độ (Citarasu et al., 2011), cá bơn (Paralichthys lethostigma) ở Mỹ (Pridgeon et al., 2014), cá Pacu Piaractus mesopotamicus ở Brazil (Carraschi et al., 2012), các loài cá chép như cá trắm cỏ (Ctenopharyngodon idellus) ở Trung Quốc (Zheng et al., 2012), cá trôi (Labeo rohita), cá catla (Catla catla) và cá trôi trắng (Cirrhinus cirrhosus) (Sarkar and Rashid, 2012) và cá rô đồng (Anabas testudineus) (Sarkar and Rashid, 2012) ở Bangladesh. Ở Việt Nam, vi khuẩn A. hydrophila cho đến nay không chỉ gây bệnh trên cá tra mà các nhà khoa học còn phân lập được vi khuẩn trên cá basa, cá bống tượng, cá trê lai và ếch (Đặng Thị Hoàng Oanh, 2006), cá rô đồng (Anabas testudineus) (Đặng Thụy Mai Thy và ctv., 2012), lươn đồng (Monopterus albus) (Đặng Thị Hoàng Oanh và Nguyễn Đức Hiền, 2012), cá thát lát còm (Chitala Chitala Hamilton, 1822) (Trần Thị Mỹ Hân, 2013) và gần đây nhất là trên cá lóc (Duc et al., 2013). Bảng 2.2: Một số đặc điểm hình thái, sinh lý và sinh hóa của vi khuẩn A. hydrophila TT Chỉ tiêu Đặc điểm* TT Chỉ tiêu Đặc điểm* 1 Gram - 13 Sinh H2S + 2 Hình dạng Que ngắn 14 Urease - 3 Di động + 15 Indole + 4 Phát triển ở 37oC + 16 Phản ứng VP + 5 Oxidase + 17 Thủy phân gelatin + 6 Catalase + 18 Thủy phân aesculin + 7 Phản ứng O/F +/+ 19 Glucose + 8 β-galactosidase + 20 Mannitol + 9 Arginine dihydrolase + 21 Inositol - 10 Lysine decarboxylase v 22 Sorbitol v 11 Ornithine decarboxylase - 23 Sucrose + 12 Simmon’s citrate v 24 Arabinose + -: âm tính; +: dương tính và v (variable reaction): phản ứng thay đổi; VP: Voges-Proskauer (phản ứng sinh acetoin); * được tổng hợp bởi Inglish et al. (1993). c. Đường lây truyền và dấu hiệu bệnh do vi khuẩn A. hydrophila Cho đến nay chưa có bất kỳ công trình nghiên cứu nào cho thấy vi khuẩn A. hydrophila xâm nhiễm vào vật chủ qua con đường nào là chủ yếu mặc dù đây là loài vi khuẩn gây bệnh trên nhiều loài cá và đã được nghiên cứu nhiều. Tuy nhiên, nhiều nghiên cứu khác cho thấy các vi khuẩn thuộc giống15 Aeromonas như vi khuẩn A. salmonicida có thể xâm nhiễm vào vật chủ qua mang, da và các vết thương (Hình 2.3) hoặc qua đường tiêu hóa (Hodgkinson et al., 1987, Svendsen et al., 1999; Janda and Abbott, 2010). Bệnh nhiễm trùng huyết do nhóm Aeromonas di động (motile aeromonad septicemia, MAS) (Harikrishnan et al., 2003) hay còn được biết đến với tên gọi khác bệnh nhiễm trùng XH (haemorrhagic septicemia) do nhóm vi khuẩn A. hydrophila, A. caviae và A. sorbia đã được báo cáo ở nhiều nước trên thế giới (Camus et al., 1998; Zhang et al., 2016). Ngoài ra, vi khuẩn A. hydrophila cũng đã phân lập được từ các loài cá bị hội chứng hội chứng lở loét (epizootic ulcerative syndrome, EUS) (Pathiratne et al., 1994; Lio-Po et al., 1998; Harikrishnan et al., 2003; Mastan and Qureshi, 2001). Cá bệnh MAS thường có các triệu chứng như sưng phồng của các mô (tissue swelling), phù (dropsy), xuất hiện các đốm đỏ/XH (red sores), hoại tử (necrosis), lở loét (ulceration) và nhiễm trùng XH (haemorrhagic septicaemia) (Karunasagar et al., 1989; Aguilar et al., 1997; Azad et al., 2001). Trên cá nheo Mỹ, bệnh MAS do vi khuẩn A. hydrophila được báo cáo là bùng phát mạnh vào năm 2009 ở Tây Alabama (Pridgeon and Klesius, 2011; Pridgeon et al., 2013). Hiện tại, bệnh này đã lây lan sang các vùng nuôi cá nheo khác như Đông Mississippi và Arkansas (Hanson et al., 2014) và gây thiệt hại cho ngành nuôi cá nheo Mỹ trên 1,3 triệu tấn cá thương phẩm, tương đương khoảng 3 tỉ đô la (Pridgeon and Klesius, 2011; Pridgeon et al., 2013). Các dấu hiệu bên ngoài của các bệnh MAS gồm các vây đỏ (reddened fins), viêm ở hậu môn, XH khắp trên da, mắt lồi (exophthalmia) và phình bụng (abdominal swelling). Một dấu hiệu khác cũng thường xuất hiện ở cá da trơn bệnh MAS là XH ở mắt (iridial haemorrhage). Các dấu hiệu bên trong gồm xoang bụng chứa dịch màu đỏ (bloody ascite), xuất huyết trên ruột, tỳ tạng và thận sưng, nhũn (swollen friable kidney and spleen) (Zhang et al., 2016). Trên cá tra, vi khuẩn A. hydrophila gây bệnh XH còn được gọi là bệnh đốm đỏ, bệnh đỏ mỏ đỏ kỳ hoặc bệnh nhiễm trùng máu (Từ Thanh Dung và ctv., 2015). Đây là 1 trong những bệnh xuất hiện tần số cao nhất trên cá tra ở ĐBSCL (Hình 2.2). Bệnh xuất hiện hầu như quanh năm, đặc biệt là khi cá bị sốc và môi trường ao nuôi không đảm bảo (Từ Thanh Dung và ctv., 2015). Bệnh XH trên cá tra thường có các biểu hiện đặc trưng như xuất hiện các đốm XH (petechial haemorrhage) ở da, tập trung nhiều ở gốc vây, xung quanh miệng, hầu và hậu môn. Bên cạnh đó, cá bệnh XH có bụng phình to, bên trong chứa dịch màu vàng hoặc màu hồng. Các nội tạng như bóng hơi, ruột và tuyến sinh dục cũng có hiện tượng XH. Ngoài ra, cá bệnh XH còn ghi nhận được các16 dấu hiệu khác như gan tái nhạt, thận và tỳ tạng sưng to, mềm nhũn và có màu đỏ sậm (Ly et al., 2009; Crumlish et al., 2010; Từ Thanh Dung và ctv., 2015). Hình 2.3: Sơ đồ minh họa quá trình xâm nhiễm của vi khuẩn Aeromonas vào vật chủ qua vết thương (Janda and Abbott, 2010). d. Khả năng gây bệnh và độc lực của vi khuẩn A. hydrophila Cho đến nay, nhiều nghiên cứu về khả năng gây bệnh và độc lực của vi khuẩn A. hydrophila trên cá đã được công bố (Azad et al., 2001; Rahman et al., 2000; Nusbaum and Morrison, 2002; Crumlish et al., 2010). Thí nghiệm cảm nhiễm trên cá nheo Mỹ (Ictalurus punctatus) của Figueirredo and Plumb (1977) cho thấy các chủng vi khuẩn A. hydrophila phân lập từ cá bệnh sẽ có độc lực (giá trị LD50 là 6,4x104 CFU/mL) cao hơn những chủng A. hydrophila phân lập từ môi trường bên ngoài (LD50 là 1,5x108 CFU/mL). Tương tự, thí nghiệm trên cá chình (Anguilla anguilla) cũng thu được giá trị LD50 khá cao (105,4-107,2 CFU/mL) (Esteve et al., 1993). Ngoài ra, Sirirat et al. (1999) cũng đã xác định được độc lực của các chủng A. hydrophila khi cảm nhiễm trên cá trê giống với giá trị LD50 cao nhất là khoảng 105 CFU/mL sau 18 giờ cảm nhiễm. Qua các nghiên cứu này cho thấy các chủng vi khuẩn A. hydrophila phân lập khác nhau sẽ có độc lực khác nhau và độc lực của chúng cũng khác nhau trên các loài cá khác nhau được gây cảm nhiễm. Giai đoạn 1: Vi khuẩn tấn công (attachment) và định cư (colonization) trên vết thương. Giai đoạn 2: Quá trình nhân lên (replication) và giải phóng các enzyme protease của vi khuẩn. Giai đoạn 3: Quá trình xâm nhiễm (invasion) và phá hủy các mô bên trong vật chủ. Da Da Da17 Ngoài ra, nhiều nghiên cứu khác còn cho thấy vi khuẩn A. hydrophila khi kết hợp với các vi khuẩn khác sẽ làm tăng độc lực gây bệnh trên cá được cảm nhiễm. Chẳng hạn, nghiên cứu của Nusbaum and Morrison (2002) cho thấy cá nheo sẽ bộc phát bệnh mạnh và các dấu hiệu lâm sàng của bệnh do vi khuẩn E. ictaluri sẽ trở nên rõ ràng hơn khi có sự xuất hiện và hiện diện của vi khuẩn A. hydrophila. Nghiên cứu của Đặng Thụy Mai Thy và ctv. (2012) cũng cho thấy khi tiêm kết hợp 2 loài vi khuẩn A. hydrophila và Streptococcus sp. trên cá rô đồng thì tỷ lệ chết của cá sẽ tăng lên đáng kể (90%) so với nghiệm thức tiêm riêng biệt từng chủng vi khuẩn (25% và 45%). Thí nghiệm gây cảm nhiễm kết hợp 2 loài vi khuẩn A. hydrophila và E. ictaluri bằng phương pháp ngâm và tiêm của Crumlish et al. (2010) trên cá tra cũng cho kết quả tương tự. Trong cả 2 phương pháp được thực hiện thì tỷ lệ cá chết ở NT chỉ ngâm/tiêm A. hydrophila hoặc E. ictaluri luôn thấp hơn đáng kể so với NT tiêm kết hợp 2 loài vi khuẩn A. hydrophila và E. ictaluri, cụ thể tỷ lệ cá chết tích lũy ở NT chỉ ngâm vi khuẩn A. hydrophila (10%) hoặc E. ictaluri (80%) thấp hơn NT ngâm kép là 95%. e. Các biến đổi về mô học của cá nhiễm bệnh do vi khuẩn A. hydrophila Cho đến nay, các kết quả nghiên cứu biến đổi về mô học của cá tra bệnh XH do vi khuẩn A. hydrophila vẫn còn hạn chế. Tuy nhiên, các biến đổi về mô học trên các loài cá khác thì được nhiều tác giả trong nước và trên thế giới công bố. Nghiên cứu mô bệnh học cá trê phi (C. gariepinus, Burchell) nhiễm vi khuẩn A. hydrophila của Laith and Najiah (2013) cho thấy da bị hoại tử, sự tăng sinh (hyperplasia) và dính lại của các sợi mang thứ cấp, đồng thời có sự thoái hóa các không bào ở gan. Báo cáo của Noor El Deen et al. (2014) cho thấy hầu hết các nội quan cá rô phi vằn (O. niloticus) như gan, thận và tỳ tạng bị hoại tử, phản ứng viêm (inflammatory reaction) cùng với hiện tượng hemosiderosis khi nhiễm vi khuẩn A. hydrophila. Nghiên cứu mô bệnh học ở cá thát lát còm (Chitala chitala) nhiễm vi khuẩn A. hydrophila của Đặng Thụy Mai Thy và ctv. (2014) cho thấy mang, gan, thận, tỳ tạng và cơ cho thấy nhiều cụm vi khuẩn được tìm thấy trong mô mang, gan, thận và tỳ tạng và các cơ quan này có biểu hiện sung huyết, XH và hoại tử ở nhiều vùng mô. Hiện tượng mất cấu trúc và hoại tử ở các ống thận cũng được ghi nhận trong nghiên cứu này. Ngoài ra, mô da cơ bị XH và cấu trúc giữa các sợi cơ rời rạc. Mô mang có hiện tượng trương phồng dính lại của các sợi mang thứ cấp, vi khuẩn trong sợi mang sơ cấp và có hiện tượng sung huyết. Nghiên cứu khác trên cá rô đầu vuông (Anabas testudineus) của Đặng Thụy Mai Thy và ctv. (2012) cho thấy mô gan, thận và tỳ tạng cá bệnh ở các NT tiêm vi khuẩn A. hydrophila có18 các hiện tượng như sung huyết, XH và hoại tử với các mức độ biến đổi khác nhau phụ thuộc thời gian gây cảm nhiễm. Tuy nhiên, cấu trúc của gan biến đổi chậm hơn thận và tỳ tạng. Gần đây, kết quả phân tích mô bệnh học cá lóc (Channa striata) bệnh XH trong nghiên cứu của Nguyễn Thị Ngọc Huyền và Đặng Thị Hoàng Oanh (2016) cho thấy nhiều vùng mô của các cơ quan gan, thận và tỳ tạng bị thay đổi cấu trúc, có hiện tượng XH và sung huyết. Bên cạnh đó, mô cơ bị hoại tử nhẹ và mô mang có hiện tượng sợi mang thứ cấp dính lại với nhau. 2.2.2.3 Bệnh trắng đuôi do vi khuẩn F. columnare Vi khuẩn F. columnare gây bệnh trắng đuôi thỉnh thoảng cũng xuất hiện trên cá tra nuôi (Từ Thanh Dung và ctv., 2012, Trần Nguyễn Diễm Tú và Đặng Thị Hoàng Oanh, 2012) nhưng với tần số thấp hơn 2 loài vi khuẩn trên. Tuy nhiên, khi bệnh này xuất hiện cũng gây hao hụt rất cao trong ao ương nuôi cá tra thâm canh ở ĐBSCL. Cá tra bệnh trắng đuôi có biểu hiện đặc trưng như cá mất nhớt, có vệt trắng trên thân, đuôi bị ăn mòn, mang xám nhạt (Từ Thanh Dung và ctv., 2012). Bệnh xảy ra chủ yếu trên cá tra ở giai đoạn nhỏ và tỷ lệ chết rất cao trong vài ngày nhiễm bệnh, đặc biệt sau khi vận chuyển cá về thả nuôi. Bệnh diễn ra thường xuyên trong năm nhưng mạnh nhất vào thời điểm nhiệt độ tăng cao. 2.2.3 Bệnh do vi nấm Vi nấm cũng là 1 trong những tác nhân thường hay xuất hiện và gây bệnh trên ĐVTS (Yanong, 2003; Khoa and Hatai, 2005). Cá tra nuôi nhiễm vi nấm khó nhận biết bằng mắt thường và thường xảy ra sau thời gian nuôi 3-5 tháng (Từ Thanh Dung và ctv., 2015). Nghiên cứu của Phạm Minh Đức và ctv. (2013) cho thấy nấm Fusarium sp. gây bệnh trên cá tra nuôi thương phẩm có dấu hiệu bệnh lý là cá thường bơi lờ đờ, bỏ ăn, bụng trương to, bên trong nội quan thấy bóng hơi trương to, mềm, có màu vàng sẫm và có dịch vàng. Nhìn chung, các kết quả nghiên cứu gần đây cho thấy vi nấm gây bệnh trên cá tra cũng rất đa dạng về thành phần giống loài. Nghiên cứu của Duc et al. (2016) đã phân lập được 2 nhóm vi nấm bậc thấp thuộc nhóm nấm thủy mi là Achlya spp. và Saprolegnia spp. trên cá tra ở giai đoạn trứng và cá bột. Ngoài ra, nhóm nấm bậc cao Fusarium spp. xuất hiện trên cá tra bệnh trương bong bóng hơi (swollen swim bladder) cũng được báo cáo bởi Duc et al. (2015). Nghiên cứu mới nhất của Đặng Thụy Mai Thy và ctv. (2016) cho thấy 5 giống nấm gồm Aspergillus sp., Fusarium sp., Achlya sp., Saprolegnia sp. và Mucor sp. đã được xác định nhiễm trên cá tra giống.19 2.2.4 Các bệnh không truyền nhiễm Ngoài KST, vi khuẩn và vi nấm thì 1 số bệnh không truyền nhiễm (non-infectious diseases) cũng xuất hiện với tần số tương đối thấp trên cá tra nuôi ở ĐBSCL như hội chứng vàng da (yellow fillet syndrome) và bệnh trắng gan trắng mang (pale gill and liver syndrome) (Đặng Thị Hoàng Oanh, 2011; Luu Thi Thanh Truc, 2013; Phu et al., 2015). Tuy nhiên, cho đến nay các nhà khoa học vẫn chưa xác định chính xác tác nhân gây hội chứng vàng da (Luu Thi Thanh Truc, 2013) cũng như bệnh trắng gan trắng mang. Theo Dung et al. (2008) thì những hội chứng này có thể liên quan đến chế độ dinh dưỡng hoặc ảnh hưởng của các yếu tố môi trường như chất lượng nước và hàm lượng oxy hòa tan trong nước. 2.3 Các nghiên cứu độc lực vi khuẩn nhiễm kép Cho đến nay, trên thế giới có nhiều nghiên cứu và báo cáo về hiện tượng nhiễm kép của vi khuẩn trên ĐVTS (Crumlish et al., 2010; Karlsen et al., 2014; Dong et al., 2015). Nhìn chung, các nghiên cứu đều cho thấy hiện tượng nhiễm kép có thể có mối tương tác hiệp lực (synergistic) hoặc đối kháng (antagonistic) khi các vi khuẩn gây bệnh cùng xuất hiện trên vật chủ (Kotob et al., 2016). Nghiên cứu của Nusbaum and Morrison (2002) cho thấy cho thấy cá nheo Mỹ (Ictalurus punctatus, Rafinesque) khi bị nhiễm vi khuẩn A. hydrophila chưa biểu hiện bệnh nhưng bệnh sẽ bộc phát mạnh khi cá nhiễm thêm vi khuẩn E. ictaluri. Nghiên cứu của Đặng Thụy Mai Thy và ctv. (2012) cho thấy cá rô khi được tiêm kép 2 loài vi khuẩn A. hydrophila (chủng A11-02) và Streptococcus sp. (chủng S11-01) đã làm cá chết với tỷ lệ là 90%, cao hơn so với cá chỉ được tiêm A. hydrophila hoặc Streptococcus sp. với tỷ lệ chết lần lượt là 25% và 45%. Ngoài ra, qua kết quả nghiên cứu cũng cho thấy thời gian cá chết ở NT tiêm kép xuất hiện sớm hơn so với phương pháp tiêm đơn. Tương tự, kết quả cảm nhiễm kép 2 loài vi khuẩn A. hydrophila và E. ictaluri bằng phương pháp tiêm và ngâm trên cá tra của Crumlish et al. (2010) cho thấy trong cả 2 phương pháp được thực hiện thì tỷ lệ cá chết ở NT chỉ tiêm/ngâm vi khuẩn A. hydrophila hoặc E. ictaluri luôn thấp hơn đáng kể so với NT tiêm/ngâm kết hợp 2 loài vi khuẩn A. hydrophila và E. ictaluri. Nghiên cứu của Loch et al. (2012) cho thấy vi khuẩn Aeromonas spp. di động (được xem như là tác nhân gây bệnh cơ hội) hiện diện với số lượng lớn trên cá hồi chinook/cá hồi vua (Oncorhynchus tshawytscha) nhưng chúng tương tác hiệp lực với vi khuẩn Renibacterium salmoninarum gây bệnh BKD (Bacterial Kidney Disease) đã làm tăng tỷ lệ chết cá. Gần đây, nghiên cứu của Dong et al. (2015) cho thấy tỷ lệ cá chết tích lũy ở NT ngâm hay tiêm kép 2 loài vi20 khuẩn F. columnare và E. ictaluri trên cá tra ở Thái Land cao hơn có ý nghĩa thống kê (P<0,05) so với NT ngâm/tiêm đơn F. columnare hay E. ictaluri. Tuy nhiên, nghiên cứu của Karlsen et al. (2014) cho thấy việc nhiễm kép vi khuẩn Moritella viscosa và Aliivibrio wodanis phân lập từ cá hồi Đại Tây dương (Salmo salar) bị hội chứng lở loét mùa đông (Winter Ulcer Syndrome) (Lunder et al., 1995) có tác dụng đối kháng (antagonistic) không làm tăng tỷ lệ chết cá nếu so sánh với việc cá chỉ nhiễm M. viscosa. Vi khuẩn A. wodanis cạnh tranh dinh dưỡng, nơi ở cũng như tiết chất ức chế bacteriocin để ức chế quá trình sinh trưởng của vi khuẩn M. viscosa làm giảm độc lực M. viscosa (Karlsen et al., 2014; Hjerde et al., 2015). 2.4 Các biện pháp kiểm soát bệnh do vi khuẩn trên cá tra nuôi ở ĐBSCL Cho đến nay, việc kiểm soát các loại bệnh do vi khuẩn gây ra trên cá tra chủ yếu vẫn dựa vào kháng sinh (Nguyễn Chính, 2005; Nguyễn Quốc Thịnh và ctv., 2014). Kết quả điều tra gần đây nhất của Phu et al. (2015) cho thấy có 24 loại kháng sinh khác nhau được sử dụng trong ao nuôi cá tra, trong đó các kháng sinh như enrofloxacin, florfenicol, doxycycline, amoxicillin và cefalexin đang được người nuôi sử dụng nhiều. Ngoài ra, qua kết quả điều tra trên cũng cho thấy hầu hết các kháng sinh thường được sử dụng kết hợp với nhau để xử lý, trong đó 2 kháng sinh sulfamethoxazole và trimethoprim được sử dụng nhiều nhất. Tuy nhiên, hiệu quả điều trị của các kháng sinh không cao do vi khuẩn đã kháng hầu hết với các loại kháng sinh này. Hiện tại, vaccine ALPHAJECT Panga 1 phòng bệnh GTM cho cá tra do công ty PHARMAQ sản xuất đã được Cục Thú Y-Bộ Nông Nghiệp và Phát triển nông thôn Việt Nam (BNN-PTNT) cấp phép lưu hành vào ngày 10/04/2013 (www.vietfish.org). Kết quả thử nghiệm vaccine phòng bệnh E. ictaluri cho cá tra của Từ Thanh Dung (2011) cho thấy việc tiêm vaccine trên là an toàn và không gây ảnh hưởng đến sinh trưởng của cá tra trong ao nuôi thương phẩm. Ngoài ra, vaccine còn kích thích hình thành miễn dịch đặc hiệu chống lại vi khuẩn E. ictaluri và bảo hộ được cá khi bệnh xảy ra trong thời gian thí nghiệm (www.vietfish.org). Tuy nhiên, vaccine vẫn chưa được sử dụng phổ biến do giá tương đối cao, mất nhiều công lao động do phải tiêm cho cá và người nuôi vẫn còn hoài nghi về hiệu quả của nó (Phu et al., 2015). Trong khi đó, việc nghiên cứu và sản xuất vaccine phòng bệnh XH trên cá tra ở nước ta cho đến nay vẫn còn hạn chế và chưa có nhiều thông tin. Hiện nay, do việc ứng dụng các vaccine đơn giá cũng như đa giá phòng bệnh GTM và XH chưa được phổ biến, trong khi việc sử dụng kháng sinh đang phải đối mặt với nhiều khó khăn thì các nghiên cứu và ứng dụng chất kích thích21 miễn dịch (immunostimulant) trên ĐVTS ngày càng được quan tâm (Nya and Austin, 2009; Mohomad et al., 2010; Nya and Austin, 2010; Mastan, 2015; Baba et al., 2016). Nghiên cứu gần đây của Bùi Thị Bích Hằng và ctv. (2015) cho thấy việc bổ sung vitamin C ở mức 500-1000mg/kg thức ăn đã kích thích gia tăng 1 số chỉ tiêu miễn dịch không đặc hiệu và tăng khả năng kháng vi khuẩn của cá tra đối với vi khuẩn A. hydrophila và E. ictaluri. Do đó, tỷ lệ cá chết giảm ở các NT có bổ sung vitamin C vào thức ăn so với NT đối chứng không có bổ sung vitamin C. Ngoài ra, việc phân lập và tuyển chọn vi khuẩn có tiềm năng sản suất chế phẩm sinh học phòng bệnh trên cá tra và các ĐVTS khác cũng được thực hiện bởi nhiều tác giả trong và ngoài nước (Ran et al., 2012; Nguyễn Thành Tâm và ctv., 2014; Trần Thị Ngọc Phương và Đặng Thị Hoàng Oanh, 2016; Ngô Thị Ngọc Trân và ctv., 2016). Kết quả nghiên cứu của Nguyễn Văn Thành và Nguyễn Ngọc Trai (2012) cho thấy vi khuẩn Lactobacillus sp. phân lập từ ruột cá tra và cá rô phi có tác dụng ức chế vi khuẩn E. ictaluri và A. hydrophila gây bệnh trên cá tra. Nhìn chung, hầu hết các nghiên cứu về lĩnh vực này vẫn chỉ dừng ở giai đoạn phân lập, tuyển chọn vi khuẩn hoặc thử nghiệm ở phòng thí nghiệm mà chưa được ứng dụng thực tế ngoài ao nuôi 1 cách rộng rãi. 2.5 Kháng sinh và cơ chế tác động của kháng sinh 2.5.1 Kháng sinh và sự kháng thuốc của vi khuẩn Theo Prescott et al. (2000) thì kháng sinh (antibiotic) là 1 hợp chất được sản xuất bởi sinh vật mà ở nồng độ thấp có thể ức chế hoặc giết chết sinh vật khác. Thuật ngữ kháng sinh đôi khi được sử dụng với tên gọi khác là chất kháng khuẩn (antimicrobial agents). Kháng sinh có thể là các chất tự nhiên, bán tổng hợp hoặc là các chất hoàn toàn tổng hợp nhưng chúng gây ít hoặc không làm tổn thương tế bào chủ (Prescott et al., 2000; Walsh, 2003). Các kháng sinh có tác dụng làm ngừng sự sinh trưởng của vi khuẩn hoặc nấm được gọi là chất kiềm khuẩn (bacteriostatic agents) hoặc giết chết chúng, gọi là chất diệt khuẩn (bactericidal agents) (Walsh, 2003). Cho đến nay, nhiều loại kháng sinh mới được sản xuất và ra đời nhằm đáp ứng các nhu cầu khác nhau của con người. Trong lĩnh vực NTTS và thú y, 1 số lượng lớn thuốc kháng sinh được sử dụng thường xuyên như trị bệnh, phòng bệnh và thậm chí kháng sinh được dùng như là chất kích thích tăng trưởng (growth promotion) (Teuber, 2001; Marshall and Levy, 2011). Nhìn chung, hầu hết các nước phát triển như Mỹ, Canada, Thụy Sỹ và các quốc gia là thành viên của châu Âu hiện nay đang có khuynh hướng giảm sử dụng hay sử dụng rất ít kháng sinh trong NTTS (Burka et al., 1997; Lillehaug et al., 2003). Trong khi đó, khoảng 90% việc sản xuất thủy sản ở các quốc gia đang22 phát triển sử dụng kháng sinh phổ biến vào trong việc phòng và kiểm soát mầm bệnh (Bondad-Reantaso et al., 2005). Theo Defoirdt et al. (2011) có khoảng 500-600 tấn kháng sinh được sử dụng ở các trại nuôi tôm ở Thái Lan vào năm 1994. Ngoài ra, tác giả còn nhấn mạnh có sự khác biệt rất lớn về lượng kháng sinh được sử dụng ở các quốc gia khác nhau trên thế giới (Bảng 2.3). Song song với việc sử dụng 1 lượng lớn kháng sinh để kiểm soát mầm bệnh thì việc xuất hiện các chủng vi khuẩn kháng thuốc đang ngày 1 gia tăng (Wegener, 2003; Serrano, 2005; Marshall and Levy, 2011). Cho đến nay, nhiều loại vi khuẩn kháng với các loại thuốc kháng sinh khác nhau đã được báo cáo (White et al., 2000; Cloeckaert et al., 2000, 2001; Schmidt et al., 2001a; Miranda and Zemelman, 2002; Miranda et al., 2003). Nhìn chung, sự kháng thuốc của vi khuẩn trong thời gian qua diễn ra rất nhanh. Nguyên nhân của hiện tượng này là do áp lực chọn lọc của kháng sinh từ môi trường sống của vi khuẩn. Theo Burridge et al. (2010) và Cabello et al. (2013) thì có khoảng 75-80% kháng sinh được phóng thích vào trong môi trường qua thức ăn. Do đó, vi khuẩn phải gia tăng sự kháng thuốc để tồn tại và thích nghi với môi trường chứa hàm lượng cao của kháng sinh. Ngoài ra, sự trao đổi của các gen kháng thuốc giữa các vi khuẩn với nhau trong các môi trường cũng là nguyên nhân làm cho sự kháng thuốc của vi khuẩn trở nên nhanh chóng (Wegener, 2003; Cabello, 2006; Heuer et al., 2009; Marshall and Levy, 2011). Bảng 2.3: Ước tính lượng kháng sinh sử dụng trong NTTS ở các quốc gia trên thế giới Quốc gia Ước tính lượng kháng sinh sử dụng (g/tấn sản xuất) Tác giả Thụy Sỹ 1 Lunestad et al. (2005) Thụy Điển 2 Turnidge and Paterson (2007) Hy Lạp 100 Rigos et al. (2004) Canada 156 Fraser et al. (2004) Chile 200 Bravo et al. (2005) Việt Nam 700 Van (2005) Các số liệu trong Bảng 2.3 được tổng hợp bởi Smith (2008). 2.5.2 Cơ chế tác động của kháng sinh Nhìn chung, các loại thuốc kháng sinh khác nhau sẽ có cơ chế tác động khác nhau lên tế bào vi khuẩn (Prescott et al., 2000; Walsh, 2003). Tuy nhiên, theo Tenover (2006); Levy and Marshall (2004) thì kháng sinh tác động lên tế bào vi khuẩn theo 1 số cơ chế (Hình 2.4) chủ yếu sau: (1) can thiệp vào quá trình tổng hợp vách tế bào (nhóm β-lactam: penicillin, ampicillin, amoxicillin, cephalosporin, monobactams; nhóm glycopeptide: vancomycin, teicoplanin), (2) ức chế sinh tổng hợp protein (nhóm macrolide, chloramphenicol,23 clindamycin, quinupristin-dalfoppristin, linezolid), (3) can thiệp vào quá trình tổng hợp acid nucleic (nhóm flouroquinolone và rifampin) và (4) ức chế quá trình biến dưỡng acid folic (nhóm sulfonamide, trimethoprim và nhóm đồng phân của acid folic). Ngoài ra, (5) kháng sinh có thể phá hủy cấu trúc màng tế bào vi khuẩn Gram âm (các kháng sinh polymyxin và daptomycin). 2.5.3 Cơ chế kháng thuốc của vi khuẩn Vi khuẩn kháng thuốc thường được thực hiện qua 2 cơ chế: đề kháng tự nhiên (intrinsic/innate resistance) hoặc đề kháng thu nhận (acquired resistance). 2.5.3.1 Đề kháng tự nhiên Đề kháng tự nhiên là do bản chất bẩm sinh hay có sẵn của vi khuẩn, tức là tình trạng 1 giống hoặc 1 loài vi khuẩn kháng với 1 loại kháng sinh nào đó mà không có bất kỳ biến đổi về cấu trúc di truyền của chúng (Hình 2.5). Điều này có thể do vi khuẩn thiếu vị trí đích cho tác động của kháng sinh. Chẳng hạn, vi khuẩn Pseudomonas spp. và Mycoplasma đề kháng tự nhiên với các kháng sinh nhóm β-lactam (Hancock, 1998; Livermore, 2002; Hatha et al., 2005; Allen et al., 2010), vi khuẩn thuộc giống Edwardsiella (gồm E. ictaluri và E. tarda) kháng tự nhiên với colistin (Muyembe et al., 1973; Waltman et al., 1986). Ngoài ra, sự đề kháng tự nhiên của vi khuẩn có thể do thành tế bào của chúng không cho kháng sinh thấm qua. Vi khuẩn Gram âm đề kháng tự nhiên với kháng sinh nhóm glycopeptide vì phân tử thuốc quá lớn nên không thể xuyên qua màng tế bào vi khuẩn. Hình 2.4: Các nhóm kháng sinh và cơ chế tác động của chúng lên tế bào vi khuẩn (Bbosa et al., 2014). Ức chế quá trình tổng hợp protein (chất ức chế 50S) Ức chế quá trình tổng hợp protein (tRNA) Ức chế quá trình tổng hợp protein (chất ức chế 30S) Ức chế quá trình tổng hợp protein (chất ức chế 30S) Ức chế quá trình tổng hợp vách tế bào Quá trình biến dưỡng acid folic Kéo dài chuỗi ARN Cấu trúc màng tế bào chất ADN gyrase24 2.5.3.2 Đề kháng thu nhận Đề kháng thu nhận hay kháng đáp ứng là trường hợp vi khuẩn trước đây nhạy cảm với kháng sinh nhưng sau 1 thời gian tiếp xúc với kháng sinh đó làm cho chúng trở nên kháng. Đề kháng thu nhận có thể là kết quả của sự thay đổi trong hệ thống gen bởi quá trình đột biến hoặc do sự du nhập gen mã hóa tính kháng thuốc từ bên ngoài qua quá trình chuyển gen ngang (horizontal gene transfer, HGT) (Rowe-Magnus et al., 1999; Sykes, 2010). Nhìn chung, vi khuẩn có thể kháng với bất kỳ kháng sinh qua 3 cơ chế chủ yếu sau (Hình 2.6): (1) sản xuất enzyme làm bất hoạt hoặc biến đổi kháng sinh (enzymatic inactivation or modification of the drug); (2) đẩy kháng sinh ra ngoài tế bào bằng hệ thống bơm protein (efflux pump) trước khi kháng sinh đến vị trí đích (decreased cell permeability and/or increased efflux from the cell surface); (3) thay đổi điểm tiếp nhận làm giảm sự gắn kết của kháng sinh với điểm tiếp nhận; giảm hấp thu kháng sinh vào tế bào vi khuẩn (alteration/modification of its targets) (Tenover, 2006; Kunz and Brook, 2010). Hình 2.5: Cơ chế đề kháng tự nhiên của vi khuẩn (Blair et al., 2015). 2.6 Sự kháng thuốc của vi khuẩn trong NTTS Việc sử dụng thường xuyên và liên tục kháng sinh trong NTTS với mục đích phòng trị bệnh và bổ sung vào trong thức ăn với 1 liều lượng thấp như là chất kích thích tăng trưởng đã tạo ra áp lực chọn lọc và dẫn đến hiện tượng kháng thuốc của vi khuẩn (Kerry et al., 1995; Marshall and Levy, 2011). Cho đến nay, trên thế giới có nhiều báo cáo về vi khuẩn kháng thuốc trên các loài ĐVTS như cá nheo Mỹ (Waltman and Shotts, 1986; Stock and Wiedemann, 2001), trên các loài cá vây (fin fish) (Starliper et al., 1993; Son et al., 1997; Ho et al., 2000; Schmidt et al., 2000; Mirand and Zemelman; 2002; Michel et Kháng sinh A Kháng sinh B Kháng sinh C Bơm thải Màng trong Màng ngoài Lổ25 al., 2003; Hatha et al., 2005; Akinbowale et al., 2006, 2007), lươn (Alcaide et al., 2005), động vật có vỏ (shellfish) (Ho et al., 2000) và thậm chí là trong các môi trường nuôi thủy sản (Petersen et al., 2000; Tendencia and de la Pena, 2001; Chelossi et al., 2003; Kim et al., 2004). Ở Việt Nam, nhiều báo cáo cho thấy sự hiện diện của vi khuẩn kháng thuốc trong các hệ thống nuôi thủy sản như E. coli, Pseudomanas spp. và Aeromonas spp. và các loài vi khuẩn khác (Đặng Thị Hoàng Oanh và ctv., 2005; Sarter et al., 2007; Nguyen et al., 2012; Trần Thị Mỹ Hân, 2013). Hình 2.6: Cơ chế kháng thuốc của vi khuẩn (Bbosa et al., 2014). 2.6.1 Sự kháng thuốc của vi khuẩn E. ictaluri Hiện tại, nhiều nghiên cứu trong và ngoài nước đã được thực hiện để đánh giá hiện trạng kháng thuốc của vi khuẩn E. ictaluri. Kết quả nghiên cứu của Waltman and Shotts (1986) cho thấy phần lớn vi khuẩn E. ictaluri phân lập trên cá nheo Mỹ nhạy đối với hầu hết các loại kháng sinh dùng để kiểm soát nhóm vi khuẩn Gram âm như aminoglycoside, cephalosporin, penicillin, quinolone, tetracycline, chloramphenicol và nitrofurantoin. Nghiên cứu cũng cho thấy vi khuẩn chỉ kháng với kháng sinh colistin và sulfonamide. Nghiên cứu tiếp theo của Reger et al. (1993) cũng cho thấy vi khuẩn E. ictaluri nhạy với enrofloxacin, gentamicin và doxycycline. Báo cáo của Stock and Wiedemann (2001) cho thấy các vi khuẩn thuộc giống Edwardsiella, kể cả vi khuẩn E. ictaluri còn nhạy với các kháng sinh thuộc nhóm quinolone nhưng Nhiễm sắc thể Enzyme bất hoạt thuốc Màng tế bào biến đổi Ức chế hấp thu thuốc Plasmid Thay đổi vi trí thuốc Mục tiêu tác động của thuốc bị biến đổi Tế bào chất Màng tế bào Tế bào vi khuẩn Bất hoạt thuốc bởi enzyme Kháng sinh Bơm thoát dòng Bất hoạt bơm26 gần đây vi khuẩn E. ictaluti đã bắt đầu kháng với nhóm kháng sinh này (Akinbowale et al., 2007). Ở ĐBSCL, sự kháng thuốc của vi khuẩn E. ictaluri trên cá tra cũng được nhiều tác giả nghiên cứu. Crumlish et al. (2002) đã tiến hành kiểm tra kháng sinh đồ vi khuẩn E. ictaluri phân lập từ cá tra nuôi ở tỉnh An Giang và Cần Thơ. Kết quả cho thấy vi khuẩn E. ictaluri phân lập trên cá tra ở tỉnh An Giang chỉ kháng với oxolinic acid trong khi vi khuẩn được phân lập từ Cần Thơ thì kháng với oxytetracyline và sulfonamide. Nghiên cứu của Từ Thanh Dung và ctv. (2004) cho thấy vi khuẩn E. ictaluri phân lập từ cá tra bệnh tại An Giang, Cần Thơ, Đồng Tháp và Vĩnh Long cũng kháng với oxytetracyline, oxolinic acid và sulfonamide. Tuy nhiên, đến năm 2008, ngoài 2 loại kháng sinh oxytetracyline và sulfonamide thì vi khuẩn này đã kháng thêm với streptomycin, trimethoprim, flumequine và enrofloxacin (Dung et al., 2008). Điểm nổi bật trong nghiên cứu này là đã xác định có trên 73% chủng vi khuẩn E. ictaluri biểu hiện sự đa kháng thuốc. Gần đây nhất, theo kết quả nghiên cứu của Nguyễn Thiện Nam và ctv. (2010) cho thấy hầu hết vi khuẩn E. ictaluri kháng với streptomycin, chloramphenicol (95%), florfenicol, enrofloxacin (77,5%) và doxycycline (67,5%). Đặc biệt, nghiên cứu này đã xác định 97,5% chủng vi khuẩn biểu hiện sự đa kháng thuốc. Tuy nhiên, nghiên cứu của Phạm Thanh Hương và ctv. (2010) cho thấy có đến 96% các chủng vi khuẩn E. ictaluri thể hiện sự đa kháng thuốc. 2.6.2 Sự kháng thuốc của vi khuẩn A. hydrophila Tương tự, nhiều nghiên cứu về sự kháng thuốc của vi khuẩn A. hydrophila trên thế giới đã được thực hiện (Guz and Kozinska, 2004; Akinbowale et al., 2007; Ashiru et al., 2011; Tipmongkolsilp et al., 2012). Đặc biệt, các nghiên cứu gần đây cho thấy hiện tượng đa kháng thuốc của vi khuẩn này đã xuất hiện ở nhiều nơi trên thế giới (Akibowale et al., 2006, 2007; Kaskhedilar and Chhabra, 2010; Stratev et al., 2013). Trên cá nheo Mỹ, vi khuẩn A. hydrophila đã kháng với nhiều loại kháng sinh như ampicillin, chloramphenicol, streptomycin, sulfonamide, tetracycline, nitrofuran và oxytetracycline (Aoki, 1988; DePaola et al., 1988). Các nghiên cứu khác cũng cho thấy vi khuẩn A. hydrophila đã kháng với các loại thuốc kháng sinh như chloramphenicol, terramycin, ampicillin, amoxicillin, sulfamethoxazole, cefalexin, oxytetracycline, oxolinc acid và erythromycin (McPheason et al., 1991; Akibowale et al., 2006; Akinbowale et al., 2007; Vivekanandhan et al., 2002). Ở nước ta, sự kháng thuốc kháng sinh của vi khuẩn A. hydrophila cũng được các nhà khoa học quan tâm và nghiên cứu, đặc biệt là vi khuẩn gây bệnh27 trên cá tra ở ĐBSCL. Nghiên cứu của Crumlish et al. (2007) cho thấy vi khuẩn này đã kháng thêm với oxytetracycline, erythromycin và acid oxolinic. Nghiên cứu của Phạm Thanh Hương và ctv. (2010) với kết quả là các chủng A. hydrophila phân lập trên cá tra tại Cần Thơ, Đồng Tháp và Sóc Trăng đã kháng cao với trimethoprim/sulfamethoxazole, streptomycin, đặc biệt trong nghiên cứu này cho thấy có đến 23% vi khuẩn A. hydrophila thể hiện sự đa kháng. Ngoài ra, nghiên cứu gần đây của Trần Thị Mỹ Hân (2013) cho thấy các chủng vi khuẩn A. hydrophila phân lập trên cá thát lát còm (Chitala Chitala Hamilton, 1822) đã kháng với ampicillin, cefazolin, colistin và streptomycin. 2.7 Hiện tượng và cơ chế đa kháng thuốc của vi khuẩn Việc sử dụng thường xuyên các loại kháng sinh để điều trị bệnh cho người cũng như trong lĩnh vực thú y và NTTS đã làm cho vi khuẩn không chỉ kháng với 1 loại kháng sinh mà còn làm cho chúng có khả năng kháng cùng lúc với nhiều loại kháng sinh (Akinbowale et al., 2007). Nhìn chung, hiện tượng đa kháng thuốc đang trở nên phổ biến ở vi khuẩn Gram âm và Gram dương (White et al., 2001; Alekshun and Levy, 2007) và gây khó khăn cho việc điều trị bệnh (Alekshun and Levy, 2007; Nikaido, 2009). Cho đến nay, ngoài vi khuẩn A. hydrophila và E. ictaluri thì hiện tượng đa kháng thuốc cũng được báo cáo ở nhiều loài vi khuẩn khác như Acinetobacter baumannii, P. aeruginosa, E. coli, K. pneumoniae, Enterococcus faecium, Staphylococcus aureus, Mycobacterium tuberculosis, Salmonella enterica serovar typhimurium, Shigella dysenteriae, Stenotrophomonas và Burkholderia (Alekshun and Levy, 2007; Džidic et al., 2008; Giedraitienė et al., 2011). Nhìn chung, sự đa kháng thuốc của vi khuẩn có thể được thực hiện thông qua 2 cơ chế chủ yếu: cơ chế thu nhận (acquired mechanism) và cơ chế tự nhiên (intrinsic mechanism). Cơ chế thu nhận là do sự hiện diện của các gen kháng thuốc khác nhau (mỗi gen mã hóa tính kháng đối với 1 kháng sinh) trên cùng bộ gen vi khuẩn (multiple antibiotic resistance genes). Cơ chế này thường liên quan đến sự đột biến ở những gen mục tiêu của kháng sinh và sự truyền gen kháng thuốc thông qua các plasmid, thực khuẩn thể (bacteriophage), gen nhảy (transposon) và các integron (Alekshun and Levy, 2007). Sự truyền gen kháng thuốc thông qua các yếu tố di truyền vận động như plasmid, transposon và integron được cho là cơ chế phổ biến nhất trong sự đa kháng thuốc của vi khuẩn xảy ra trong môi trường (Davies, 1994; White et al., 2001; Alekshun and Levy, 2007). Trong khi đó, ở cơ chế tự nhiên (intrinsic mechanism) thì vi khuẩn đa kháng thuốc được thực hiện nhờ hệ thống bơm thoát dòng (multidrug efflux pumps) (Alekshun and Levy, 2007;28 Nikaido, 2009). Hiện nay, ít nhất 5 họ protein (Hình 2.7) liên quan đến hệ thống bơm thoát dòng đã được báo cáo, gồm họ RND (resistance nodulation division), họ MFS (major facilitator superfamily), họ SMR (staphylococcal multiresistance), họ MATE (multidrug and toxic compound extrusion) và siêu họ ABC (ATP binding cassette) (Piddock, 2006). Hình 2.7: Các hệ thống bơm đa kháng của vi khuẩn (Piddock, 2006). 2.8 Các yếu tố di truyền vận động liên quan đến sự kháng thuốc của vi khuẩn 2.8.1 Plasmid Plasmid là các phân tử ADN mạch đôi, dạng vòng hoặc thẳng (circular/linear double-stranded DNA) nằm ngoài ADN nhiễm sắc thể của vi khuẩn. Chúng có thể tự nhân lên độc lập với tế bào chủ (extra-chromosomal DNA self-replicating genetic element) do có vị trí khởi đầu sao chép (ori hay origin of replication) (Leplae et al., 2004; Frost et al., 2005). Các plasmid thường có kích thước từ vài kilobase pairs (kbp) đến vài trăm kbp (Waters, 1999). Trong 1 tế bào vi khuẩn có thể có từ 1 đến nhiều loại plasmid khác nhau và mỗi loại có thể có nhiều bản sao trong tế bào. Nhìn chung, các plasmid đóng vai trò quan trọng đến việc phát tán của các gen kháng kháng sinh do chúng mang các gen kháng kháng sinh (các R-plasmid, resistance plasmid) và trên plasmid có chứa gen tra (transfer gene) giúp cho plasmid có thể di chuyển từ vi khuẩn này sang vi khuẩn khác trong cùng 1 loài hoặc khác loài với nhau (Hình 2.8). Tuy nhiên, ngày nay các plasmid được xem là nhân tố quan trọng gây nên hiện tượng đa kháng thuốc ở vi khuẩn do chúng mang Họ MATE MFS Họ SMR Họ RND Siêu họ ABC Màng tế bào Tế bào chất29 các gen mã hóa cho việc kháng lại nhiều loại kháng sinh như β-lactam, macrolide, aminoglycoside, tetracycline, trimethoprim/sulfamethoxazole và phenicol (Nikaido, 2009). Thêm vào đó, các yếu tố di truyền vận động khác như gen nhảy (transposon), đoạn xen/đoạn chèn (insertion sequence) và các integron mang các gen kháng thuốc thường định vị trên các plasmid nên việc phát tán và truyền gen kháng thuốc của vi khuẩn có thể xảy ra ở tần suất cao (Waters, 1999; Cambray et al., 2010). Hình 2.8: Sự trao đổi gen kháng thuốc qua plasmid ở vi khuẩn (Levy and Marshall, 2004). 2.8.2 Các integron Stokes and Hall (1989) lần đầu tiên đã phát hiện và mô tả các yếu tố di truyền vận động, được gọi là integron có khả năng thu nhận gen (gene capture system) ở nhiều loài vi khuẩn. Các integron có khả năng nhận biết, bắt giữ 1 hay nhiều gen cassette (gen cassette thường là các gen mã hóa sự đề kháng với kháng sinh) (Cambray et al., 2010). Do integron có khả năng thu giữ 1 hay nhiều gen cassette, các vi khuẩn mang integron thường có hiện tượng đa kháng thuốc (Collis and Hall, 1992; Collis and Hall, 1995). Các integron thường hiện diện phổ biến ở vi khuẩn Gram âm, đặc biệt là ở các loài vi khuẩn thuộc họ Enterobacteriaceae (White et al., 2001). Cấu trúc chung của các integron bao gồm 1 vùng chức năng (functional platform, vùng bảo tồn 5’-CS: 5’-conserved segment): mang các thành phần cần thiết cho hệ thống hoạt động và 1 vùng biến đổi (variable region) chứa Sự đột biến Nhiễm sắc thể Gen nhảy Thực khuẩn thể ADN tự do30 nhiều gen cassette mã hóa tính kháng kháng sinh (Hình 2.9). Vùng chức năng của integron gồm có 3 vị trí quan trọng: vị trí mang gen tổng hợp enzyme tyrosine recombinase (IntI gene) có chức năng xúc tác quá trình cắt và định hướng sự gắn vào integron của các gen cassette (Stokes and Hall, 1989), điểm gắn vào của gen cassette ở 1 vị trí chuyên biệt được gọi là attI (Collis et al., 1993) và 1 promotor (Pc). Các integron bản thân chúng không thể di chuyển nhưng chúng thường gắn với các yếu tố di truyền vận động khác như các gen nhảy (transposon) hoặc các plasmid tiếp hợp (conjugative plasmid), nhờ đó mà chúng có thể phát tán gen kháng thuốc trong cùng 1 loài (intraspecies) và giữa các loài với nhau (interspecies) (Davies and Davies, 2010). Hình 2.9: Cấu trúc chung của các integron và cơ chế thu nhận các gen cassette của integron (Davies, 2008). Các integron được chia làm 2 loại: loại liên kết với các yếu tố di truyền vận động như gen nhảy hoặc các plasmid tiếp hợp, gọi là các integron di động (mobile integron/MIs) và loại nằm trên nhiễm sắc thể, gọi là integron nhiễm sắc thể (chromosomal integron-CIs hoặc super-integron). Các integron nhiễm sắc thể thường không liên quan đến kiểu hình kháng thuốc của vi khuẩn (Cambray et al., 2010). Các integron di động được chia thành nhiều nhóm khác nhau dựa trên trình tự amino acid của các gen integrase tương ứng, các gen này thường tương đồng từ 45-58% (Rowe-Magmus et al., 2002). Cho đến nay, các nhà khoa học trên thế giới đã phát hiện được ít nhất 5 nhóm integron di động, trong số đó thì các integron nhóm 1 và nhóm 2 là những integron hiện diện phổ biến ở các vi khuẩn có kiểu hình đa kháng thuốc và chúng thu hút sự31 quan tâm của các nhà khoa học do có khả năng phát tán các gen kháng thuốc có thể xảy ra trong cùng 1 loài và giữa các loài với nhau (White et al., 2001). 2.8.2.1 Các integron nhóm 1 Cấu trúc chung của các integron nhóm 1 (class 1 integrons) gồm vùng 5’-CS và 3’-CS bị chia cắt bởi vùng biến đổi chứa 1 hoặc nhiều gen cassette (Rodríguez et al., 2006) (Hình 2.10). Vùng 5’-CS là vùng chức năng chứa gene integrase (intI1), điểm tiếp hợp (attI1) và 1 promoter (Pc) cho phép gen cassette gắn vào attI1 ở 1 hướng thích hợp. Vùng 3’-CS của các integron nhóm 1 bao gồm gen qacEΔ1 (qacEΔ1 gane) mã hóa tính kháng đối với các hợp chất ammonia bậc 4 (quaternary ammonium compounds) và gen sul1 (sul1 gene) mã hóa gen kháng với kháng sinh nhóm sulfonamide và 2 khung đọc mở: orf5 và orf6 (open reading frame) (Partridge et al., 2009). Các integron nhóm 1 thường hiện diện phổ biến ở vi khuẩn đa kháng thuốc và được phát hiện ở nhiều loài vi khuẩn Gram âm như Acinetobacter, Aeromonas, Alcaligenes, Burkholderia, Campylobacter, Citrobacter, Enterobacter, Escherichia, Klebsiella, Pseudomonas, Salmonella, Serratia, Shigella và Vibrio (Fluit and Schmitz, 2004). Hình 2.10: Cấu trúc chung của các integron nhóm 1 (Aleskshun and Levy, 2007). 2.8.2.2 Các integron nhóm 2 Các integron nhóm 2 (class 2 integron) thường liên kết với tranposon Tn7 (Collis and Hall, 1995). Integron nhóm 2 không chứa gen sul1 nhưng nó chứa các gen có vai trò thúc đẩy sự chuyển vị của Tn7 (Radstrom et al., 1994; Recchia and Hall, 1995). Theo Hansson et al. (2002) thì gen integrase của integron nhóm 2 (IntI2) có tỷ lệ tương đồng với gen integrase của integron nhóm 1 là 46%. Các integron nhóm 2 thường xuất hiện ở các vi khuẩn thuộc họ Enterobacteriaceae, đặc biệt là ở vi khuẩn E. coli (White et al., 2001; Crespo et al., 2005; Machado et al., 2005; Pan et al., 2006). Integron nhóm 2 thường chứa các gen ereA (kháng với erythromycin); catB2 (kháng chloramphenicol), aadB (kháng gentamicin, tobramycin và kanamycin), dfr32 (kháng trimethoprim), sat (kháng streptothrycin) và estX (mã hóa cho esterase giả định) (Partridge et al., 2009). 2.8.2.3 Các integron nhóm 3, 4 và 5 Ngoài các integron nhóm 1 và 2 thì các integron nhóm 3, 4 và 5 cũng được phát hiện ở vi khuẩn. Tuy nhiên, chỉ 1 số ít các nghiên cứu về các integron nhóm này được báo cáo. Các integron nhóm 3 lần đầu tiên được phát hiện bởi Arakawa et al. (1995) từ các chủng vi khuẩn Serratia marcescens kháng carbapenem. Trong khi, các integron nhóm 4 và 5 đã được báo cáo từ 1 số loài Vibrio kháng với trimethoprim (Hochhut et al., 2001; Cambray et al., 2010). 2.8.2.4 Các gen cassette Gen cassette là những yếu tố di truyền vận động nhỏ nhất và không có khả năng sao chép, thường chỉ chứa 1 gen đơn và 1 điểm tái tổ hợp (attC) hay còn gọi là 59-be (59-base element) (Labbate et al., 2009). Hầu hết các gen cassette không có promoter (vùng khởi động) nên hoạt động của chúng phụ thuộc vào promoter (Pc) của integron mà chúng chèn vào (Cambray et al., 2010). Do đó, nó không thể tự nhân đôi ở trạng thái tự do. Nhiều gen cassette có thể chèn vào cùng 1 integron nên gây ra hiện tượng đa kháng (Partridge et al., 2009). Hiện nay, theo báo cáo của các nhà khoa học thì có hơn 130 gen cassette khác nhau đã được xác định (Fluit and Schmitz, 2004; Partridge et al., 2009). Trong đó, có hơn 80 gen cassette khác nhau từ integron nhóm 1 đã được phát hiện và chúng thường mã hóa cho sự đề kháng với các kháng sinh như aminoglycoside, chloramphenicol, trimethoprim, streptothricin, rifampin, erythromycin, fosfomycin, lincomycin, các hợp chất amino bậc 4 và các kháng sinh thuộc nhóm β – lactam (Rowe-Magmus and Mazel, 2002; Fluit and Schmitz, 2004). 2.9 Hiện tượng trao đổi gen kháng thuốc giữa các loài vi khuẩn trong tự nhiên 2.9.1 Các quá trình tiếp hợp và trao đổi gen kháng thuốc của vi khuẩn Sự trao đổi vật liệu di truyền của vi khuẩn có thể diễn ra qua 2 hình thức, đó là quá trình chuyển gen ngang (lateral hoặc horizontal gene transfer, LGT/HTG) và chuyển gen thẳng (vertical gene transfer hoặc vertical evolution) (Hình 2.11). Quá trình chuyển gen thẳng là do vi khuẩn ban đầu không có gen kháng thuốc nhưng sau đó bị đột biến có gen kháng thuốc và khi vi khuẩn có gen này thì chúng có thể truyền trực tiếp gen kháng thuốc của chúng cho các thế hệ con cháu của chúng qua quá trình tái bản ADN (DNA replication) (Madhavan and Murali, 2011).33 Trong khi đó, sự chuyển gen ngang là quá trình mà vật liệu di truyền có thể trao đổi giữa các vi khuẩn trong cùng 1 loài hoặc khác loài với nhau (Dröge et al., 1999). Quá trình này giữ vai trò rất quan trọng trong việc phát tán các gen kháng thuốc giữa các vi khuẩn trong tự nhiên (de la Cruz and Davies, 2000). Cho đến nay, có ít nhất 3 cơ chế liên quan quá trình chuyển gen ngang của vi khuẩn đã được phát hiện, đó là quá trình biến nạp (transformation), tải nạp (transduction) và tiếp hợp (conjugation). Biến nạp là 1 trong những hình thức chuyển gen ngang lần đầu tiên được phát hiện bởi Griffith ở vi khuẩn Streptococcus pneumoniae (Griffith, 1928), còn tải nạp do các thực khuẩn thể (phage) thì ít được biết đến. Trong khi đó, tiếp hợp được xem là 1 trong những cơ chế phổ biến nhất để vi khuẩn để trao đổi vật chất di truyền (Mazel and Davies, 1999; Norman et al., 2009). Hình 2.11: Các quá trình chuyển gen ngang ở vi khuẩn (Furuya and Lowy, 2006). 2.9.2 Các kết quả nghiên cứu liên quan đến khả năng truyền gen kháng thuốc giữa nhóm vi khuẩn gây bệnh ở ĐVTS và vi khuẩn E. coli Cho đến nay, trên thế giới đã nhiều nghiên cứu chứng minh nhiều loài vi khuẩn có thể tiếp hợp và chuyển gen kháng thuốc của chúng cho vi khuẩn E. coli (Kruse and Sorum, 1994; Agersø and Sandvang, 2005; Cabello, 2006; Van et al., 2007; Heuer et al., 2009; Xu et al., 2011; Marshall and Levy, 2011; Tremblay et al., 2011). Trong lĩnh vực thủy sản, nhiều nghiên cứu cho thấy các vi khuẩn gây bệnh trên cá như Aeromonas spp., E. ictaluri, Pseudomonas spp. có thể chuyển gen kháng thuốc của chúng sang vi khuẩn E. coli (Sorum and Sunde, 2001; Sorum and L’Abee, 2002; Sorum et al., 2003; Dung et al., 2009; Nguyen et al. , 2014). Kết quả nghiên cứu của Son et al. (1997) cho34 thấy trong số các chủng vi khuẩn A. hydrophila AH4, AH5, AH9, AH10, AH11 và AH19 phân lập từ cá rô phi đen/cá rô phi cỏ (Telapia mossambica) gây bệnh loét da (skin ulcer) ở Malaysia được chọn thí nghiệm tiếp hợp thì chỉ có chủng AH11 có thể chuyển các plamid có ích thước 6,2 kbp và 63,4 kbp (kháng ampicillin and tetracycline) sang vi khuẩn E. coli K12. Nghiên cứu của Schmidt et al. (2001a) cho thấy 17/40 chủng thuộc nhóm Aeromonas di động kháng oxytetracycline thu thập từ các trại nuôi cá hồi ở Đan Mạch đã chuyển các plasmid lớn của chúng (110 kbp và 160 kbp) sang vi khuẩn E. coli CSH26Rf. Nghiên cứu khác của Schmidt et al. (2001b) cũng cho thấy 15/16 chủng A. salmonicida gây bệnh nhọt (furunculosis) trên cá hồi ở Bắc Âu và Bắc Mỹ có thể chuyển các R-plasmid của chúng sang vi khuẩn E. coli CSH26Rf. Kết quả tiếp hợp của Yoo et al. (2003) ghi nhận vi khuẩn Vibrio damsela JE1 có thể chuyển các R-plasmid mang các gen kháng chloramphenicol và tetracycline sang vi khuẩn E. coli K-12 HB101. Nghiên cứu của Furushita et al. (2003) chúng minh các chủng vi khuẩn Photobacterium, Vibrio, Pseudomonas, Alteromonas, Citrobacter và Salmonella spp., phân lập từ 3 địa điểm nuôi cá loài cá như cam sọc vàng (Seriola lalandi), cá cam Nhật Bản (Seriola quinqueradiata), cá cam sọc (Seriola dumerili) và cá ngừ vây xanh Đại Tây dương (Thunnus thynnus) đã chuyển các gen tetB, tetY hoặc tetD sang vi khuẩn E. coli HB-101 sau khi tiếp hợp. Vi khuẩn A. salmonicida gây bệnh trên cá hồi mang R-plasmid (pRAS1, kích thước 45 kbp) kháng tetracycline, trimethoprim và sulfonamide có thể chuyển sang vi khuẩn E. coli (Sorum et al., 2003). Lần đầu tiên trong nghiên cứu của Agerso et al. (2007) chứng minh gen tetE nằm trên plasmid có kích thước 150 kpb của vi khuẩn Aeromonas spp. phân lập từ cá nuôi ở Đan Mạch có thể chuyển sang vi khuẩn E. coli. Ở Úc, nghiên cứu của Akinbowale et al. (2007) cho thấy 5/12 chủng vi khuẩn kháng oxytetracycline (gồm 4 chủng Aeromonas WA12, WA13, WA14 và WA15 và 1 chủng Vibrio QV5) có thể chuyển R-plasmid (mang các gen kháng tetracycline: tetA, tetD và tetM) của chúng sang vi khuẩn E. coli (từ gà heo và người). Tuy nhiên, không phải tất cả các gen này cùng được chuyển từ vi khuẩn cho sang vi khuẩn nhận. Chẳng hạn, 2 chủng A. hydrophila WA12 và WA14 mang các gen tetD, tetE và tetM nhưng chỉ có tetD và tetM hoặc chỉ riêng tetM chuyển sang chủng vi khuẩn nhận, trong khi đó chủng A. hydrophila WA13 mang gen tetA và tetM chỉ chuyển tetA sang vi khuẩn nhận. Đặc biệt, qua kết quả tiếp hợp của nghiên cứu này cũng cho thấy bên cạnh gen kháng tetracycline thì các gen kháng thuốc kháng sinh khác như cephalothin, chloramphenicol, trimethoprim, sulphamethoxazole, sulphonamide và trimethoprim/sulphamethoxazole cũng được đồng vận chuyển (co-transfer) sang vi khuẩn nhận. Trên cá tra, kết quả35 nghiên cứu của Dung et al. (2009) cho thấy các chủng vi khuẩn E. ictaluri mang plasmid không tương hợp (IncK) có thể chuyển sang vi khuẩn E. coli. Kết quả nghiên cứu của Shah et al. (2014) cho thấy trong số 9 chủng vi khuẩn được chọn để khảo sát khả năng tiếp hợp thì 2 chủng Marinobacter litoralis và Stenotrophomonas maltophilia có nguồn gốc từ địa điểm nuôi cá hồi có thể chuyển cả 2 gen tetA và sul2 sang vi khuẩn E. coli. 2.10 Sự kháng tetracycline của vi khuẩn 2.10.1 Tổng quan về kháng sinh nhóm tetracycline Tetracycline thuộc nhóm kháng sinh phổ rộng (broad-spectrum), có hoạt tính ức chế nhiều loài vi khuẩn Gram âm và Gram dương hiếu khí và kỵ khí (Roberts, 2003). Xét về mặt dược lý, các kháng sinh thuộc nhóm này có thể chia là 2 thế hệ: thế hệ 1 gồm các kháng sinh có nguồn gốc tự nhiên (tetracycline, oxytetracycline, chlortetracycline và demeclocycline); thế hệ 2 gồm các kháng sinh có nguồn gốc bán tổng hợp (doxycycline và minocycline) (Chopra et al., 1992; Chopra and Roberts, 2001; Prescott, 2000). Chlortetracycline là loại kháng sinh thuộc nhóm tetracycline lần đầu tiên được phát hiện vào 1948 từ loài Streptomyces aureofaciens (Chopra et al., 1992; Chopra and Roberts, 2001). Nhìn chung, các kháng sinh nhóm tetracycline có cấu trúc hóa học giống nhau, chúng chỉ khác nhau ở các gốc R. 2.10.2 Cơ chế hoạt động của kháng sinh nhóm tetracycline Nhìn chung, tất cả các kháng sinh nhóm tetracycline có cơ chế hoạt động là ức chế quá trình tổng hợp protein của tế bào vi khuẩn (Hình 2.12) (Speer et al., 1992; Chopra and Roberts, 2001). Sau khi khuếch tán vào bên trong tế bào vi khuẩn, kháng sinh tetracycline sẽ gắn vào các thụ thể (receptor) trên tiểu đơn vị 30S của ribosome vi khuẩn làm cho các tRNA vận chuyển acid amin không thể gắn vào điểm A (A site) trên ribosome nên chuỗi peptide không thể kéo dài, vì vậy quá trình tổng hợp protein không thể xảy ra (Chopra and Roberts, 2001). 2.10.3 Cơ chế kháng tetracycline của vi khuẩn Trước giữa thập niên 1950, hầu hết các vi khuẩn đều nhạy với tetracycline (van Hoek et al., 2011). Ngày nay, do các kháng sinh nhóm tetracycline có độc tính và chi phí thấp (van Hoek et al., 2011) nên thường được sử dụng rộng rãi trong NTTS để kiểm soát các nguồn bệnh, trong đó oxytetracycline thường được sử dụng ở hầu hết các nước có ngành công nghiệp nuôi cá (Sorum et al., 1992; Miranda et al., 2003). Do đó, nhiều nghiên cứu đã phát hiện nhiều loài vi khuẩn kháng tetracycline gây bệnh trên cá đã xuất hiện trong NTTS (DePaola et al., 1988; Schmidt et al., 2001a; Miranda et al., 2003). Ngày nay, vi khuẩn kháng tetracycline đã xuất hiện thường xuyên36 hơn, đặc biệt là nhóm vi khuẩn thuộc họ Enterobacteriaceae (Chopra and Roberts, 2001). Hình 2.12: Cơ chế hoạt động của các kháng sinh thuộc nhóm tetracycline (www.antibiotics-info.org/tetracycline.html). Theo Zakeri and Wright (2008) thì hiện nay đã có 4 cơ chế kháng đáp ứng tetracycline (acquired tetracycline) (Hình 2.13) của vi khuẩn đã được phát hiện: (1) vi khuẩn giảm nồng độ của tetracycline trong tế bào bằng hệ thống bơm thải (efflux pumps) (Roberts, 1996), (2) phá vỡ sự tương tác giữa ribosome-tetracycline bằng các protein bảo vệ ribosome (RPPs-ribosomal protection proteins) (Roberts, 1996), (3) bất hoạt kháng sinh bởi enzyme (enzymatic inactivation) thông qua quá trình gọi là monohydroxylation (Yang et al., 2004) và (4) cơ chế sau cùng là thay đổi vị trí đích (target site) tác dụng của kháng sinh bằng đột biến vùng 16S rRNA (Ross et al., 1998). Trong số các cơ chế trên thì 2 cơ chế kháng tetracycline qua các protein bảo vệ ribosome và hệ thống bơm thải là phổ biến và thường gặp nhất ở vi khuẩn (Chopra and Roberts, 2001). Hình 2.13: Các cơ chế kháng tetracycline ở vi khuẩn (Zakeri and Wright, 2008). Bảo vệ ribosome Bất hoạt bởi enzyme Hệ thống bơm thải Thay đổi mục tiêu Chuỗi polypeptide Điểm A Điểm P mARN37 Cho đến nay, có khoảng 45 gen kháng đáp ứng tetracycline khác nhau đã được xác định, gồm 40 gen tet (kháng tetracycline), 3 gen otr (kháng oxytetracycline) và 1 gen tcr (Roberts, 1996, 2005; Brown et al., 2008). Trong số các gen này, có 29 gen mã hóa cho hệ thống bơm thải (gồm 26 gen tet, 2 gen otr và 1 gen tcr), 12 gen mã hóa cho các protein bảo vệ ribosome (11 gen tet và 1 gen otr), 3 gen tet liên quan cơ chế bất hoạt kháng sinh bằng enzyme (Bảng 2.4). Tuy nhiên, cho đến nay cơ chế kháng tetracycline của gen tetU vẫn chưa được sáng tỏ. Các gen mã hóa tính kháng tetracycline thường nằm trên các yếu tố di truyền vận động (mobile genetic element) như các plasmid hoặc gen nhảy (transposon) (Speer et al., 1992). Bảng 2.4: Các gen kháng đáp ứng tetracycline Cơ chế Gen Efflux pumps (bơm đẩy) tetA, tetA(P), tetB, tetC, tetD, tetE, tetG, tetH, tetJ, tetK, tetL, tetV, tetY, tetZ, tet30, tet31, tet33, tet35, tet38, tet39, tet40, tet41, tet42, tet43, tet45, tet46, otrB, otrC và tcr. Ribosomal protection (protein bảo vệ) tetB (P), tetM, tetO, tetQ, tetS, tetT, tetW, tet32, tet36, tet44, tet và otrA. Enzymatic inactivation (bất hoạt bởi enzyme) tetX, tet34 và tet37. Unknown (chưa biết) tetU Roberts et al. (2012) 2.11 Sự kháng florfenicol của vi khuẩn 2.11.1 Tổng quan về kháng sinh nhóm phenicol Phenicol thuộc nhóm kháng sinh phổ rộng, bao gồm các loại như chloramphenicol (C11H12Cl2N2O5), thiamphenicol (C12H15Cl2N2O5S), florfenicol (C12H14Cl2NO4SF) và florphenicol amine (C10H14Cl2NO3SF). Các kháng sinh thuộc nhóm phenicol có hoạt tính kháng khuẩn rất mạnh, có tác dụng đối với cả vi khuẩn Gram âm và Gram dương (Schwarz et al., 2004). Nhìn chung, các kháng sinh nhóm này có cấu trúc hóa học tương tự nhau, chỉ khác nhau ở gốc R. Chloramphenicol đã được sử dụng phổ biến trong chăn nuôi thú ý mãi cho đến khi độc tính của nó được phát hiện. Do đó, hiện nay chloramphenicol đã bị cấm sử dụng trong lĩnh vực thú y và trong NTTS. Florfenicol là dẫn xuất của chloramphenicol với nhóm p-methyl sulfonyl và fluorine thay thế cho nhóm p-nitro và hydroxyl trong cấu trúc của chloramphenicol. Florfenicol được ứng dụng rộng rãi trong ngành thú y và được sử dụng trong NTTS ở châu Á từ những thập niên 1980 (Keyes et al., 2000). Ở Châu Âu, florfenicol được sử dụng để trị bệnh truyền nhiễm đường hô hấp ở gia súc vào năm 1995 và trên heo vào năm 2000. Ở Mỹ, nó cũng được Cơ Quan quản lý Dược và38 Thực phẩm (Food and Drug Administration) cho phép sử dụng vào năm 1996 để điều trị các nguồn bệnh trên đường hô hấp của bò và sử dụng trong NTTS (Fernandez-Alcarcon et al., 2010). 2.11.2 Cơ chế hoạt động của kháng sinh nhóm phenicol Ở Việt Nam, chloramphenicol cùng với kháng sinh enrofloxacin (thuộc nhóm quinolone) hiện đang bị cấm sử dụng trong NTTS. Tuy nhiên, florfenicol thì vẫn được phép sử dụng trong NTTS ở nước ta (Thông tư số 03/2012/TT-BNNPTNT). Tương tự như chloramphenicol, cơ chế hoạt động của của florfenicol là gắn vào tiểu đơn vị 50S của ribosome và ức chế enzym peptidyl transferase. Do đó ngăn cản việc chuyển các acid amin từ phân tử tRNA đến chuỗi peptide của protein đang tổng hợp làm ức chế quá trình sinh tổng hợp protein của vi khuẩn (Schwarz et al., 2004). 2.11.3 Cơ chế kháng florfenicol của vi khuẩn Việc sử dụng florfenicol trong thú y và NTTS trong thời gian qua đã làm xuất hiện nhiều loài vi khuẩn khác nhau trở nên kháng florfenicol như Klebsiella pneumoniae (Cloeckaert et al., 2001), Escherichia coli (Keyes et al., 2000; Cloeckaert et al., 2000; White et al., 2000), Vibrio cholerae (Hochhut et al., 2001). Kết quả nghiên cứu về hiện tượng kháng thuốc của vi khuẩn E. ictaluri trên cá tra của Nguyễn Thiện Nam và ctv. (2010) cũng cho thấy 77,5% vi khuẩn kháng với florfenicol. Cho đến nay, cơ chế kháng florfenicol của vi khuẩn vẫn chưa được làm sáng tỏ. Tuy nhiên, các nhà khoa học đã xác định được 2 cơ chế có thể dẫn đến việc kháng chloramphenicol và florfenicol của vi khuẩn, đó là sự bất hoạt chloramphenicol bằng enzyme bởi quá trình gọi là acetyl hóa (acetylation) thông qua các chloramphenicol acetyltransferase khác nhau (Murray and Shaw, 1997) và do các bơm (chloramphenicol exporter) có tác dụng đẩy chloramphenicol và florfenicol ra khỏi tế bào vi khuẩn (Schwarz et al., 2004). Gần đây, gen floR được xem là gen giúp vi khuẩn đề kháng lại với chloramphenicol và florfenicol (Schwarz et al., 2004). Gen này mã hóa cho protein màng, protein này hoạt động như cái bơm để đẩy chloramphenicol và florfenicol từ bên trong tế bào vi khuẩn ra ngoài. Vì thế, không đủ lượng kháng sinh cần thiết để thể hiện hoạt tính đối với vi khuẩn (Kim and Aoki, 1996).39 Chương III. PHƯƠNG TIỆN VÀ PHƯƠNG PHÁP NGHIÊN CỨU 3.1 Nội dung nghiên cứu Để đạt được các mục tiêu đề ra, đề tài thực hiện các nội dung của luận án theo sơ đồ mô tả (Hình 3.1) như sau: Hình 3.1: Sơ đồ minh họa các nội dung nghiên cứu chính của luận án. 3.2 Phương tiện nghiên cứu 3.2.1 Thời gian và địa điểm thí nghiệm Thời gian: các thí nghiệm của luận án được thực hiện trong thời gian từ tháng 01/2013 đến tháng 04/2016. Địa điểm thực hiện: đề tài được thực hiện tại phòng Sinh học Phân tử (Viện NC&PT Công nghệ Sinh học) và các phòng Thí nghiệm của Bộ môn Bệnh học Thuỷ sản (Khoa Thuỷ sản), trường Đại học Cần Thơ (ĐHCT). 3.2.2 Dụng cụ và thiết bị thí nghiệm Tủ cấy vi sinh vật Totelstar AV-100 (Tây Ban Nha), tủ ủ vi sinh vật Incucell 55 (Đức), máy ly tâm Biofuge pico Heraus D-37520 Osterode (Đức), bộ điện di một chiều BioRad (Mỹ), máy đọc và chụp hình gel Bio-Rad Mẫu cá tra bệnh (GTM và XH) và mẫu nước ao nuôi ở ĐBSCL Phân lập và định danh vi khuẩn E. ictaluri, A. hydrophila và E. coli Nghiên cứu các đặc điểm bệnh học cảm nhiễm kép 2 loài vi khuẩn E. ictaluri và A. hydrophila trên cá tra. Khảo sát tính nhạy cảm kháng sinh của các chủng vi khuẩn E. ictaluri và A. hydrophila. Xác định độc lực và giá trị LD50 của các chủng vi khuẩn E. ictaluri và A. hydrophila. Xác định cơ chế đa kháng thuốc của 2 loài vi khuẩn E. ictaluri và A. ydrophila: - Xác định các integron nhóm 1, 2 và 3. - Các plasmid kháng thuốc. - Các gen kháng thuốc kháng sinh. - Thí nghiệm tiếp hợp vi khuẩn.40 Universal HoodII (Mỹ), máy PCR Perkin Elmer 9700 (Mỹ), kính hiển vi Olympus CHT (Nhật), máy đo pH để bàn (Eutech, Singapore), máy đúc khối Microm EC 350 (Đức), máy xử lý mẫu mô Tissue processing Microm STP 120 (Đức) và máy cắt mô microtome PR 50 (Nhật) và các dụng cụ khác. 3.2.3 Môi trường và hóa chất thí nghiệm * Môi trường và hóa chất phân lập, nuôi cấy và trữ vi khuẩn: Môi trường TSA (Merck, Đức) hoặc BHI (Merck, Đức), GSP (Merck, Đức) dùng để phân lập vi khuẩn E. ictaluri và A. hydrophila. Môi trường MCK (Merck, Đức) dùng để phân lập và nuôi cấy vi khuẩn E. coli và thực hiện thí nghiệm tiếp hợp. Môi trường BHIB (Merck, Đức) hoặc TSB (tryptic soya broth, Merck, Đức) dùng để nhân sinh khối vi khuẩn. * Hóa chất dùng để khảo sát các đặc điểm sinh lý và sinh hóa của vi khuẩn: Que thử oxidase (Oxidase Test Strips, Merck, Đức) dùng để kiểm tra hoạt tính oxidase của vi khuẩn. Hydrogen peroxide (H2O2, Merck, Đức) dùng để kiểm tra hoạt tính catalase của vi khuẩn. Môi trường BA (blood agar, có bổ sung 5% máu cừu) (Merck, Đức) dùng để kiểm tra khả năng tan huyết (hemolytic activity) của vi khuẩn. Môi trường oxidation/fermentation (môi trường O/F, Merck, Đức) dùng để kiểm tra khả năng lên men và oxid hóa đường glucose của vi khuẩn. Bộ kít nhuộm Gram (Merck, Đức) vi khuẩn gồm các dung dịch: crystal violet (dung dịch I), iodine (dung dịch II), cồn: aceton (dung dịch III), safranin (dung dịch IV). Thành phần và cách chuẩn bị các dung dịch được trình bày chi tiết ở Phụ lục A1. Bộ kít thương mại API 20E kit (BioMerieux, Pháp) định danh nhanh các vi khuẩn E. ictaluri, A. hydrophila và E. coli sau khi phân lập. * Hóa chất dùng để trích và trữ ADN vi khuẩn: Tris (hydroxymethyl) aminomethane hydrochloride (Tris–HCl, Himedia, Ấn Độ), ethylenediaminetetraacetic acid (EDTA, Sigma, Mỹ), sodium dodecyl sulfate (SDS, Merck, Đức), isoamylalcohol (Merck, Đức), ethanol (Merck, Đức), chloroform (Merck, Đức), cetyl trimethyl ammonium bromide (CTAB, Himedia, Ấn Độ), proteinase K (Fermentas, Mỹ), dung dịch TE (pH 8,0): Tris-HCl (10 mM) và EDTA (1mM).41 * Hóa chất dùng để trích ADN vi khuẩn từ mẫu mô: sử dụng bộ kít thương mại DNeasy Blood&Tissue Kit (Qiagen, Mỹ) để trích ADN vi khuẩn từ mẫu mô cá được cảm nhiễm 2 loài vi khuẩn E. ictaluri và A. hydrophila. * Hóa chất dùng để thực hiện phản ứng PCR: PCR Amplification Buffer GL Plus (PCR buffer, LifeTechnologies, Ấn Độ), MgCl2 25 mM (Fermentas, Mỹ), deoxyribonucleotide triphosphate (dNTPs) gồm: dATP (100 mM), dTTP (100 mM), dCTP (100 mM) và dGTP (100 mM) (Fermentas, Mỹ), Taq DNA-polymerase (Fermentas, Mỹ), dimethyl sulfoxide (DMSO, Merck, Đức). Các loại mồi (primer) dùng để nhận diện vi khuẩn E. ictaluri và A. hydrophila; xác định các integron nhóm 1, 2 và 3; các gen kháng tetracycline (tet gene): tetA, tetB, tetC, tetD, tetE, tetG, tetK, tetL, tetM, tetO, tetS và tet34 và gen kháng florfenicol (floR gene) do công ty Integrated DNA Technologies (IDT, Mỹ) tổng hợp. * Hóa chất điện di sản phẩm PCR: agarose (Merk, Đức), Tris-borate-acetate-EDTA (5X TBE Buffer: Tris base (0,445 M), boric acid (0,445 M) và EDTA (12,5 mM) (Fermentas, Mỹ), loading dye/loading buffer (Fermentas, Mỹ), ethidium bromide (EtBr, Merck, Đức) hoặc SafeView (Merck, Đức), các thang chuẩn ADN gồm 100 bp, 100 bp plus, 1 kbp (Fermentas, Mỹ) và thang chuẩn HyperLadderTM 1 kbp (Bioline, Anh) dùng để xác định kích thước các sản phẩm PCR và kích thước plasmid ở 2 loài vi khuẩn. * Hóa chất dùng để nhuộm mẫu phết kính (nhuộm Wright-Giemsa): Dung dịch Wright gồm: bột Wright và methanol (Merck, Đức). Dung dịch Giemsa gồm: bột Giemsa, glycerol và methanol (Merck, Đức). Dung dịch pH 6,2-6,8 gồm: monobacsic sodium phosphate (NaH2PO4), dibasic sodium phosphate (Na2HPO4, Merck, Đức). Dung dịch pH 6,2 gồm: acid citric (C6H8O7), Na2PO4.7H2O (Merck, Đức). Thành phần, nồng độ và cách pha dung dịch dung dịch Wright, Giemsa, pH 6,2-6,8 và dung dịch pH 6,2 được trình bày chi tiết ở Phụ lục A2. * Hóa chất dùng để xử lý và nhuộm mẫu mô: Xylene, sáp ong, paraffin (Merck, Đức). Dung dịch formol trung tính (Neutral buffered formalin, NBF) gồm: formol, NaH2PO4, Na2HPO4 (Merck, Đức). Dung dịch Harris’s haematoxyline gồm: haematoxyline, alcohol, potassium alum, mercuric oxide, glacial acetic acid (Merck, Đức).42 Dung dịch Eosin gồm: Eosin, Phloxine, ethanol, glacial acetic acid (Merck, Đức). Dung dịch potassium acetate: potassium acetate (Merck, Đức) và nước cất. Thành phần, nồng độ và cách pha các dung dịch NBF, Harris’s haematoxyline, Eosin và dung dịch potassium acetate được trình bày chi tiết ở Phụ lục A3. * Các kháng sinh đĩa dùng để thực hiện kháng sinh đồ: amoxicillin (AMO/10 µg), ampicillin (AMP/10 µg), cefotaxime (CTX/30 µg), cefalexin (CFL/30 µg), chloramphenicol (CHL/30 µg), florfenicol (FFC/30 µg), ciprofloxacin (CIP/5 µg), enrofloxacin (ENR/5 µg), norfloxacin (NOR/5 µg), doxycycline (DOX/30 µg), tetracycline (TET/30 µg), gentamicin (GEN/10 µg), streptomycin (STR/10 µg), neomycin (NEO/30 µg) và trimethoprim/sulfamethoxazole (SXT/1,25/23,75 µg). Tất cả các loại kháng sinh trên được mua từ hãng Oxoid của Anh. * Hóa chất dùng để trích ADN plasmid vi khuẩn: bộ kít trích plasmid vi khuẩn: ISOLATE II Plasmid Mini Kit (Bioline, Anh). 3.2.4 Vật liệu thí nghiệm Mẫu cá tra nhiễm bệnh GTM và bệnh XH thu thập từ các ao nuôi ở 1 số tỉnh ĐBSCL dùng để phân lập vi khuẩn E. ictaluri và A. hydrophila. Ngoài ra, 1 số mẫu cá bệnh và mẫu nước ao nuôi cá tra cũng được thu thập để phân lập vi khuẩn E. coli dùng trong các thí nghiệm tiếp hợp. Cá tra giống (trọng lượng khoảng 12-20 g) dùng để thực hiện các thí nghiệm cảm nhiễm, gồm cảm nhiễm đơn và cảm nhiễm kép 2 loài vi khuẩn E. ictaluri và A. hydrophila. Cá được mua từ trại cá tra giống ở Hồng Ngự - Đồng Tháp và được thuần dưỡng ở trại thí nghiệm cảm nhiễm của khoa Thủy sản, ĐHCT. Chủng vi khuẩn E. coli ATCC 25922 dùng để làm đối chứng phương pháp thực hiện kháng sinh đồ. 3.3 Phương pháp nghiên cứu 3.3.1 Địa điểm và phương pháp thu mẫu cá tra bệnh Cá tra có biểu hiện bệnh GTM (cá bệnh có các đốm trắng nhỏ li ti trên gan, thận và tỳ tạng) và bệnh XH (XH ở vùng mắt, xung quanh miệng, hậu môn và ở các vây hoặc có dịch bên trong xoang bụng) hoặc có dấu hiệu nhiễm kép 2 loại bệnh trên được thu ở các ao nuôi cá tra. Mẫu cá bệnh được thu ở các tỉnh của ĐBSCL như An Giang, Đồng Tháp, Tp. Cần Thơ, Vĩnh Long, Bến43 Tre, Trà Vinh và Tiền Giang (Hình 3.2). Mỗi ao nuôi thu từ 3-4 cá bệnh với trọng lượng cá dao động từ 22 đến 700 g/con. Để phân lập vi khuẩn E. ictaluri, nghiên cứu đã thu 125 mẫu cá tra (gồm 90 mẫu cá có dấu hiệu bệnh GTM và 35 mẫu cá nhiễm kép bệnh GTM và XH) và 130 mẫu cá bệnh (gồm 95 mẫu cá bệnh XH và 35 mẫu cá nhiễm kép bệnh GTM và XH) để phân lập vi khuẩn A. hydrophila. Ngoài ra, trong quá trình thu mẫu phân lập 2 loài vi khuẩn trên có kết hợp thu mẫu nước ao nuôi cá tra để phân lập vi khuẩn E. coli (mẫu nước được thu bằng cách ở mỗi ao nuôi chọn 1-2 vị trí và cho nước vào chai nhựa tiệt trùng). Thông tin về số mẫu cũng như địa điểm thu mẫu được trình bày chi tiết ở Phụ lục B và Phụ lục J1, J2 và J3. Mẫu cá có thể được giải phẩu, cấy vi khuẩn trực tiếp tại địa điểm thu mẫu hoặc được cho vào trong thùng đá (có sục khí) và mang về phòng thí nghiệm để tiến hành công tác phân lập vi khuẩn. Mẫu cá bệnh được thu ở các thời điểm khác nhau trong vụ nuôi cho đến khi phân lập được số chủng vi khuẩn cần thiết cho thí nghiệm (phân lập được 120 chủng, gồm 60 chủng vi khuẩn E. ictaluri và 60 chủng vi khuẩn A. hydrophila). Hình 3.2: Các địa điểm thu mẫu cá tra công nghiệp ở vùng ĐBSCL ( : địa điểm thu mẫu). 3.3.2 Phân lập và định danh vi khuẩn E. ictaluri và A. hydrophila 3.3.2.1 Phân lập vi khuẩn Vi khuẩn E. ictaluri và A. hydrophila được phân lập từ các cơ quan như gan, thận và tỳ tạng của cá tra bệnh dựa theo tài liệu hướng dẫn của Frerich and Millar (1993). Các bước phân lập được thực hiện như sau:44 a) Phân lập vi khuẩn E. ictaluri và A. hydrophila Lau sạch chất nhầy trên da cá và sử dụng cồn 70º tiệt trùng bên ngoài cơ thể cá. Dùng kéo tiệt trùng tiến hành giải phẫu cá. Dùng dao mổ rạch 1 đường nhỏ trên thận (hoặc gan và tỳ tạng). Đặt que cấy đã tiệt trùng vào nơi vừa rạch, xoay nhẹ để lấy mẫu bệnh phẩm và cấy lên môi trường TSA. Sau đó, các đĩa được ủ trong tủ ủ từ 36-48 giờ ở 28oC. Tiến hành cấy chuyển nhiều lần các khuẩn lạc nghi ngờ trên môi trường TSA và kiểm tra độ ròng (thuần) của các chủng vi khuẩn phân lập trên kính hiển vi quang học. Các chủng vi khuẩn sau khi tách khuẩn lạc thuần sẽ được trữ trong trong môi trường BHIB (brain heart infusion broth) chứa glycerol 20% ở nhiệt độ -80oC. Trong khi đó, các bước phân lập vi khuẩn A. hydrophila được thực hiện tương tự như phân lập vi khuẩn E. ictaluri. Vi khuẩn A. hydrophila cũng được phân lập trên môi trường TSA từ các cơ quan như gan, thận và tỳ tạng của cá tra bệnh. Tuy nhiên, thời gian ủ vi khuẩn từ 18-36 giờ ở 28oC. b) Phân lập vi khuẩn E. coli Nghiên cứu sử dụng các mẫu cá bệnh (n=10) và mẫu nước ao nuôi cá tra (n=10) để phân lập vi khuẩn E. coli trên môi trường MCK dựa theo phương pháp của Samuel et al. (2011) bằng cách cấy ria trực tiếp mẫu ruột cá và mẫu nước lên môi trường phân lập (trường hợp cần thiết có thể pha loãng mẫu). Sau đó, các đĩa được ủ ở nhiệt độ 37oC trong thời gian khoảng 24 giờ. Sau 24 giờ ủ, khuẩn lạc vi khuẩn E. coli có màu tím, tiến hành giai đoạn cấy chuyền và trữ glycerol mẫu vi khuẩn thuần để sử dụng cho các thí nghiệm sau. Các đặc điểm về hình thái, sinh lý và sinh hóa cơ bản của vi khuẩn E. coli được kiểm tra và thực hiện tương tự như A. hydrophila và E. ictaluri được trình bày trong mục 3.3.2.2a&b. Đối với vi khuẩn E. coli thì nghiên cứu không sử dụng kỹ thuật sinh học phân tử mà chỉ sử dụng bộ kít API 20E để định danh vi khuẩn do chúng được phân lập trên môi trường chuyên biệt và khuẩn lạc vi khuẩn cũng có màu sắc đặc trưng (Zinnah et al., 2007). Các chủng vi khuẩn sau khi phân lập sẽ được kiểm tra kháng sinh đồ (phương pháp thực hiện tương tự mục 3.3.5.1) với 15 loại kháng sinh (mục 3.3.5.1) nhằm chọn được chủng vi khuẩn cần thiết cho các thí nghiệm tiếp hợp. Ngoài ra, vi khuẩn được chọn để tiếp hợp cũng được kiểm tra sự hiện diện của các integron nhóm 1, 2 và 3, các gen kháng sulfonamide (sul1, sul2 và sul3), gen kháng tetracycline, florfenicol và các plasmid (phương pháp thực hiện tương tự các mục 3.3.6.1, 3.3.6.3 và 3.3.6.4).45 3.3.2.2 Phương pháp định danh vi khuẩn E. ictaluri và A. hydrophila a) Kiểm tra các đặc điểm hình thái, sinh lý và sinh hóa của 2 loài vi khuẩn Tất cả các chủng vi khuẩn E. ictaluri và A. hydrophila sau khi tách khuẩn lạc thuần sẽ được kiểm tra các đặc điểm về hình thái, sinh lý và sinh hóa cơ bản như hình dạng, màu sắc, kích thước khuẩn lạc, hình dạng tế bào (được xác định bằng phương pháp nhuộm Gram (Phụ lục C1), khả năng chuyển động (Phụ lục C2), các phản ứng oxidase, catalase, phản ứng O/F (Phụ lục C3) và khả năng tan huyết của vi khuẩn (Phụ lục C4). Các chỉ tiêu này được thực hiện theo cẩm nang của Cowan và Steel (Barrow and Feltham, 1993) và tài liệu hướng dẫn của Buller (2004). Ngoài ra, các đặc điểm sinh hóa quan trọng khác của 2 loài vi khuẩn (gồm 6 chủng E. ictaluri và 6 chủng A. hydrophila) cũng được kiểm tra bằng bộ kít thương mại API 20E (Phụ lục C5) nhằm mục đích định danh vi khuẩn được chính xác. Bên cạnh đó, 1 số chủng vi khuẩn (gồm 4 chủng E. ictaluri và 4 chủng A. hydrophila được chọn để cảm nhiễm) còn được gửi chụp ảnh dưới kính hiển vi điện tử quét (Scanning Electron Microscope, SEM) tại phòng Thí nghiệm Chuyên sâu của trường ĐHCT. Mẫu vi khuẩn sau khi được làm thuần sẽ được cố định trên lam kính giống như cách chuẩn bị tiêu bản trong phương pháp nhuộm Gram vi khuẩn (Phụ lục C1) hoặc có thể gửi các đĩa cấy có khuẩn lạc thuần để chụp SEM. b) Định danh vi khuẩn E. ictaluri và A. hydrophila bằng kỹ thuật PCR và giải trình tự Tất cả các chủng vi khuẩn E. ictaluri (n=67) và A. hydrophila (n=74) sau khi phân lập sẽ được định danh bằng kỹ thuật PCR. Vi khuẩn dùng để trích ADN được nuôi trong môi trường TSB hoặc môi trường BHIB, ủ qua đêm ở nhiệt độ phòng trên máy lắc (110 vòng/phút). Sau đó, tiến hành trích ADN vi khuẩn theo phương pháp của Neumamn et al. (1992). Các bước thực hiện được trình bày chi tiết ở Phụ lục D. ADN ly trích từ 2 loài vi khuẩn sẽ được trữ ở nhiệt độ -20oC trước khi sử dụng. Sử dụng cặp mồi Edi-F: 5’CAG ATG AGC GGA TTT CAC AG 3’ và Edi-R: 5’ CGC GCA ATT AAC ATA GAG CC3’ (Sakai et al., 2009) để khuếch đại vùng đầu nguồn (upstream region) của gen bám dính (fimbrial gene) ở vi khuẩn E. ictaluri với kích thước là 470 bp. Phản ứng PCR được thực hiện trong thể tích 25 μL gồm các thành phần sau: dung dịch đệm 1X PCR; 2,5 mM MgCl2; 10 mM dNTPs; 2U Taq DNA polymerase; 20 pmol mồi xuôi (Edi-F); 20 pmol mồi ngược (Edi-R); DMSO (1%) và 20-40 ng ADN mẫu. Chu kỳ và các điều kiện thực hiện phản ứng PCR dựa theo qui trình của Sakai et al. (2009) có cải biên và hiệu chỉnh gồm các bước sau: biến tính ban46 đầu ở 95oC trong 5 phút. Sau đó thực hiện 40 chu kỳ gồm biến tính ở 94oC trong 30 giây, gắn mồi ở 65oC trong 30 giây, kéo dài ở 72oC trong 60 giây và giai đoạn kéo dài sau cùng ở 72oC trong 10 phút. Trong khi đó, cặp mồi AeroFd: 5’CCA AGG GGT CTG TGG CGA CA 3’ và AeroRs: 5’ TTT CAC CGG TAA CAG GAT TG 3’ (Pollard et al., 1990) được sử dụng để khuếch đại vùng đặc hiệu trên gen aerolysin của vi khuẩn A. hydrophila với kích thước là 209 bp. Thể tích và thành phần phản ứng PCR dùng để định danh vi khuẩn A. hydrophila gồm dung dịch đệm 1X PCR; 2,5 mM MgCl2; 10 mM dNTPs; 2U Taq DNA polymerase; 20 pmol mồi xuôi (AeroFd); 20 pmol mồi ngược (AeroRs); DMSO (1%) và 20-40 ng ADN mẫu. Tuy nhiên, chu kỳ và các điều kiện thực hiện phản ứng PCR dựa theo qui trình của Pollard et al. (1990) có cải biên và hiệu chỉnh gồm các bước sau: biến tính ban đầu ở 95oC trong 4 phút. Sau đó thực hiện 30 chu kỳ gồm giai đoạn biến tính ban đầu ở 95oC trong 30 giây, gắn mồi ở 60oC trong 45 giây, kéo dài ở 72oC trong 30 giây và kéo dài sau cùng ở 72oC trong 10 phút. Sản phẩm PCR sau khi khuếch đại được điện di trên gel agarose 1,5% trong dung dịch đệm TBE 1X ở 95V với thời gian từ 30-45 phút. Kết quả điện di được đọc và chụp gel trên máy BioRad UV 2000 (Hoa Kỳ). Căn cứ vào thang ADN chuẩn 100 bp hoặc 100 bp plus để xác định kích thước đoạn ADN của vi khuẩn E. ictaluri và A. hydrophila cần xác định. Chọn 1 số chủng vi khuẩn E. ictaluri (n=12) và A. hydrophila (n=12) đại diện cho 1 số tỉnh ở ĐBSCL để giải trình tự tại công ty Macrogen, Hàn Quốc (www.macrogen.com). Kết quả giải trình tự các chủng vi khuẩn được so sánh độ tương đồng với các trình tự trên cơ sở dữ liệu NCBI (National Center for Biotechnology Information)(www.ncbi.nlm.nih.gov) bằng chương trình BLAST (Basic Local Alignment Search Tool) để định danh chúng kết hợp với kết quả khảo sát các đặc điểm hình thái, sinh lý và sinh hóa truyền thống và bộ kít API 20E. 3.3.3 Xác định độc lực của các chủng vi khuẩn E. ictaluri và A. hydrophila 3.3.3.1 Chuẩn bị thí nghiệm Cá tra giống: cá dùng để thí nghiệm có trọng lượng khoảng 12-20 g/con. Cá mua về được nuôi thuần dưỡng khoảng 1-2 tuần trong bể nhựa có thể tích khoảng 500-1000 L có sục khí và cho ăn hằng ngày theo nhu cầu. Trước khi bố trí thí nghiệm, bắt ngẫu nhiên 10-15 cá để kiểm tra vi khuẩn (thực hiện tương tự như mục 3.3.2.1) và KST (thực hiện theo tài liệu hướng dẫn của Hà Ký và Bùi Quang Tề (2007) và Noga (2010), chi tiết được trình bày ở Phụ lục E) nhằm lựa chọn được cá khỏe và không nhiễm bệnh.47 3.3.3.2 Chuẩn bị vi khuẩn gây cảm nhiễm Bốn chủng vi khuẩn E. ictaluri (1ED3, 3ED3, 8ED3 và 10ED3) và 4 chủng vi khuẩn A. hydrophila (1A3, 2A3, 4A3 và 5A3) đại diện cho 1 số tỉnh nuôi khác nhau ở ĐBSCL và nguồn gốc vi khuẩn phân lập trên cá nhiễm bệnh (Bảng 3.1) được chọn để xác định độc lực và khả năng gây bệnh của chúng trên cá tra. Trước khi tiến hành thí nghiệm, các chủng vi khuẩn được phục hồi (nếu trữ bằng glycerol) trên môi trường TSA, kiểm tra lại độ thuần và các chỉ tiêu cơ bản như nhuộm Gram, hoạt tính oxidase và catalase, phản ứng O/F và các đặc điểm sinh lý, sinh hóa bằng bộ kít API 20E (kết quả này không trình bày lại trong luận án). Sau đó, vi khuẩn được phục hồi độc lực bằng cách tiêm vi khuẩn cho cá từ 2-3 lần (số liệu này không trình bày trong luận án này). Bảng 3.1: Thông tin các chủng vi khuẩn E. ictaluri và A. hydrophila được chọn thí nghiệm cảm nhiễm. TT Chủng vi khuẩn Nguồn gốc Mẫu cá tra bệnh 1 1ED3* Tp. Cần Thơ Cá bệnh GTM 2 3ED3 Trà Vinh Cá bệnh GTM và XH 3 8ED3 Đồng Tháp Cá bệnh GTM và XH 5 10ED3 Vĩnh Long Cá bệnh GTM 5 1A3 Trà Vinh Cá bệnh GTM và XH 6 2A3 Vĩnh Long Cá bệnh XH 7 4A3* Đồng Tháp Cá bệnh GTM và XH 8 5A3 Tp. Cần Thơ Cá bệnh XH * Các chủng vi khuẩn được chọn bố trí thí nghiệm cảm nhiễm kép. Sau khi phục hồi độc lực, vi khuẩn được nuôi tăng sinh trong 20-25 mL môi trường BHIB và ủ qua đêm ở nhiệt độ phòng trên máy lắc 110 vòng/phút. Vi khuẩn được ly tâm 4.000-6.000 vòng/phút trong 10 phút ở 4oC để thu sinh khối tế bào. Sau đó, vi khuẩn được rửa qua nước muối sinh lý (NaCl 0,85%) 3 lần và đo mật số bằng máy so màu quang phổ ở bước sóng 610 nm (OD = 1±0,1 tương ứng với mật số của vi khuẩn E. ictaluri là 109 CFU/mL, còn đối với vi khuẩn A. hydrophila là 108 CFU/mL) (Crumlish et al., 2010). Dịch vi khuẩn sau đó được pha loãng thành các mật số 102, 103, 104, 105 và 106 CFU/mL để tiêm cho cá. 3.3.3.3 Bố trí thí nghiệm Thí nghiệm xác định độc lực của các chủng vi khuẩn E. ictaluri và A. hydrophila được bố trí hoàn toàn ngẫu nhiên với 42 nghiệm thức (NT), bao gồm: 40 NT tiêm vi khuẩn (mỗi chủng vi khuẩn tiêm 5 nồng độ: 102, 103, 104, 105 và 106 CFU/cá) và 2 NT đối chứng (NT tiêm và không tiêm nước muối sinh lý NaCl 0,85%). Mỗi NT lặp lại 3 lần với mật độ 10 con/bể và cá thí nghiệm được tiêm 0,1 mL dung dịch vi khuẩn/cá ở xoang bụng. Như vậy, tổng số cá được sử dụng để bố trí thí nghiệm là 1260 con.48 3.3.3.4 Cách xác định liều gây chết 50% cá thí nghiệm Liều gây chết 50% cá thí nghiệm (LD50, lethal dose) của 2 loại vi khuẩn trong thí nghiệm được xác định theo công thức của Reed and Muench (1938) như sau: LD50 = 10a-pxd với pd = (L% - 50%)/(L% - H%), trong đó a: số lũy thừa mà tại đó vi khuẩn gây chết cá thấp nhất (trên 50%); H: tỷ lệ cá chết cao nhất (dưới 50%) và L: tỷ lệ cá chết thấp nhất (trên 50%). 3.3.4 Nghiên cứu đặc điểm bệnh học cảm nhiễm kép 2 loài vi khuẩn E. ictaluri và A. hydrophila trên cá tra 3.3.4.1 Bố trí thí nghiệm cảm nhiễm kép 2 loại vi khuẩn trên cá tra Từ kết quả của các thí nghiệm cảm nhiễm đơn, 2 chủng vi khuẩn 1ED3 và 4A3 có độc lực cao nhất với giá trị LD50 lần lượt là 1,58x104 và 1,29x103 CFU/mL được chọn để gây cảm nhiễm kép trên cá tra. Các bước tiến hành thí nghiệm cảm nhiễm kép được thực hiện tương tự như phương pháp cảm nhiễm đơn. Thí nghiệm cảm nhiễm kép được thực hiện qua 2 phương pháp ngâm và tiêm vi khuẩn (Hình 3.3). Trong phương pháp ngâm, thí nghiệm được bố trí hoàn toàn ngẫu nhiên với 5 NT (mỗi NT được lặp lại 3 lần với mật số 10 con/bể) gồm: 2 NT đối chứng (ngâm và không ngâm cá tra trong dung dịch nước muối sinh lý NaCl 0,85%), 3 NT ngâm (2 NT ngâm đơn và 1 NT ngâm kép) cá trong dung dịch chứa 2 chủng vi khuẩn 1ED3 và 4A3 với mật số lần lượt là 106 và 105 CFU/mL (Hình 3.3). Thời gian ngâm cá tra trong dung dịch vi khuẩn ở các NT trên khoảng 30-60 phút. Sau đó, cá sẽ được phân phối vào các xô nhựa (60 L) có sục khí để theo dõi thí nghiệm. Trong khi đó, ở phương pháp tiêm thì thí nghiệm cũng được bố trí hoàn toàn ngẫu nhiên với 7 NT (mỗi NT cũng được lặp lại 3 lần với mật số 10 con/bể) gồm: 2 NT đối chứng tiêm và không tiêm nước muối sinh lý NaCl 0,85% (cá ở NT tiêm nước muối sinh lý được tiêm 2 lần) và 5 NT tiêm vi khuẩn ở các thời điểm tiêm khác nhau (bao gồm 1 NT tiêm vi khuẩn A. hydrophila trước 12 giờ tiêm vi khuẩn E. ictaluri, 1 NT tiêm cùng lúc vi khuẩn A. hydrophila và E. ictaluri và 3 NT tiêm vi khuẩn A. hydrophila sau 24, 48 và 72 giờ tiêm vi khuẩn E. ictaluri). Mật số vi khuẩn A. hydrophila (chủng 4A3) và E. ictaluri (chủng 1ED3) sử dụng trong tất cả các NT tiêm trên là 103 và 104 CFU/cá. Như vậy, tổng số NT trong thí nghiệm cảm nhiễm kép của 2 phương pháp ngâm và tiêm là 12 NT và số cá sử dụng để bố trí thí nghiệm là 360. 3.3.4.2 Các chỉ tiêu theo dõi thí nghiệm cảm nhiễm đơn và kép Sau khi gây cảm nhiễm biểu hiện của cá ở tất cả các NT nhiễm đơn và kép được theo dõi liên tục trong 14 ngày (thời gian quan sát này dựa theo các thí nghiệm cảm nhiễm trên 2 loài vi khuẩn này đã được thực hiện bởi các49 nghiên cứu trước đây). Tất cả cá vừa mới chết hoặc có dấu hiệu lờ đờ, bơi lội kém linh hoạt được thu lấy để ghi nhận thời gian vi khuẩn gây bệnh, dấu hiệu biểu hiện bệnh (bên ngoài và bên trong cơ thể), tỷ lệ cá chết, tái phân lập và định danh vi khuẩn E. ictaluri và A. hydrophila, thực hiện phết kính mẫu tươi (nhuộm Wright-Giemsa) với số mẫu là n=180 và thu mẫu mô (nhuộm Haematoxylin và Eosin, H&E) ở 5 cơ quan cá bệnh là mô da-cơ, mang, gan, thận và tỳ tạng với số mẫu là n=180 (cá ở các NT cảm nhiễm đơn không thu mẫu mô và 1 số mẫu cá bệnh (n= 120) được thực hiện phết kính mẫu tươi). Ngoài ra, các chỉ tiêu môi trường như nhiệt độ và pH cũng được theo dõi 2 lần/ngày (buổi sáng lúc 6 giờ và buổi chiều lúc 5 giờ) trong 14 ngày sau khi cảm nhiễm vi khuẩn (đo trực tiếp bằng máy đo pH để bàn) tại địa điểm cảm nhiễm vi khuẩn). a) Phương pháp tái phân lập và định danh vi khuẩn Tất cả cá lờ đờ hoặc vừa mới chết ở các NT thí nghiệm (bao gồm NT đối chứng) đều được giải phẩu để tái phân lập vi khuẩn E. ictaluri và A. hydrophila từ các cơ quan như gan, thận và tỳ tạng của cá sau khi cảm nhiễm (phương pháp thực hiện tương tự mục 3.3.2.1a). Các đặc điểm về hình thái, sinh lý và sinh hóa; việc tái định danh vi khuẩn bằng bộ kít API 20E và kỹ thuật PCR được thực hiện tương tự mục 3.3.2.2a&b. Mẫu ADN vi khuẩn được sử dụng trong phản ứng PCR gồm mẫu ADN được trích từ khuẩn lạc vi khuẩn tái phân lập từ cá bệnh và từ mô gan hoặc thận cá (bao gồm cá nhiễm đơn và kép) sau khi cảm nhiễm. Phương pháp trích ADN từ khuẩn lạc vi khuẩn thì được thực hiện tương tự mục 3.3.2.2b (Phụ lục D), trong khi ADN vi khuẩn trích từ mẫu mô thì được thực hiện bằng bộ kít thương mại DNeasy Blood&Tissue Kit (Qiagen, Mỹ). Qui trình thực hiện dựa theo hướng dẫn của nhà sản xuất và được trình bày chi tiết ở Phụ lục F. Vi khuẩn sau khi cảm nhiễm từ các các mẫu mô sẽ được phát hiện bằng kỹ thuật duplex-PCR dựa theo phương pháp của Panangala et al. (2007) và Lê Hữu Thôi và ctv. (2010) có hiệu chỉnh và bổ sung. Đối với phương pháp duplex-PCR phát hiện đồng thời 2 loài vi khuẩn A. hydrophila và E. ictaluri thì được thực hiện tương tự như kỹ thuật PCR sử dụng trong phần định danh vi khuẩn ở mục 3.3.2.2b. Tuy nhiên, điểm khác biệt trong phương pháp duplex-PCR là sử dụng cùng lúc 2 cặp mồi và 2 mẫu ADN của vi khuẩn để phát hiện vi khuẩn A. hydrophila và E. ictaluri thay vì kỹ thuật PCR thường chỉ sử dụng duy nhất 1 cặp mồi và 1 mẫu ADN của vi khuẩn khi thực hiện phản ứng khuếch đại đoạn gen cần tìm. Phản ứng duplex-PCR cũng được thực hiện trong thể tích 25 hoặc 50 μL với các thành phần sau dịch đệm 1X PCR; 2,5 mM MgCl2; 20 mM dNTPs; 2U Taq DNA polymerase; 20 pmol mồi xuôi50 (Edi-F và AeroFd); 20 pmol mồi ngược (Edi-R và AeroRs); DMSO (1%) và ADN mẫu vi khuẩn E. ictaluri và A. hydrophila. Chu kỳ và các điều kiện thực hiện phản ứng duplex-PCR gồm các bước sau: biến tính ban đầu ở 95oC trong 4-5 phút. Sau đó thực hiện 30-35 chu kỳ gồm giai đoạn biến tính ban đầu ở 95oC trong 30 giây, gắn mồi ở 60oC-62oC trong 45 giây, kéo dài ở 72oC trong 30 giây đến 1 phút và kéo dài sau cùng ở 72oC trong 10 phút. b) Phương pháp phết kính mẫu tươi Dùng dao cắt 1 phần nhỏ mẫu da-cơ, mang, gan, thận và tỳ tạng cá và phết nhẹ lên lame sạch. Để khô tự nhiên, sau đó cố định lame bằng dung dịch methanol trong 1 phút và nhuộm Wright-Giemsa theo phương pháp của Chinabut (1991). Cho lame mẫu vào dung dịch Wright trong 3-5 phút. Chuyển mẫu sang dung dịch pH 6,2-6,8 từ 5-6 phút. Sau đó cho vào dung dịch Giemsa trong 20-30 phút. Tiếp tục cho mẫu vào dung dịch pH 6,2 từ 15-30 phút. Rửa sạch mẫu bằng nước cất, để khô tự nhiên. Quan sát và đọc kết quả dưới kính hiển vi ở vật kính 100X. c) Phương pháp mô học Các mẫu da-cơ, mang, gan, thận và tỳ tạng của cá lờ đờ từ các NT cảm nhiễm kép và cá từ NT đối chứng được thu và cố định trong dung dịch formol trung tính 10% (NBF, neutral buffered formalin). Sau 24 giờ, tiến hành rửa và trữ mẫu trong cồn 70% cho đến khi phân tích mô học. Các bước cắt và nhuộm mô được trình bày chi tiết ở Phụ lục G. Mẫu được xử lý qua 3 giai đoạn: loại nước, làm trong mẫu và tẩm paraffin. Sau đó mẫu được đúc khối, cắt lát với độ dày từ 4-6 μm và nhuộm H&E (Ferguson, 2006). Tiêu bản được quan sát dưới kính hiển vi quang học lần lượt ở 10X, 20X, 40X và 100X. Sau cùng, đọc kết quả và chụp hình tiêu bản đặc trưng ở độ phóng đại thích hợp.51 Hình 3.3: Sơ đồ minh họa phương pháp bố trí thí nghiệm cảm nhiễm đơn và cảm nhiễm kép các chủng vi khuẩn E. ictaluri và A. hydrophila trên cá tra. Chuẩn bị cá giống Cá khoẻ: 12-20 g/con Chuẩn bị vi khuẩn cảm nhiễm Bể thí nghiệm (xô nhựa 60 lít) Bố trí thí nghiệm cảm nhiễm đơn 4 chủng vi khuẩn A. hydrophila Đối chứng 4 chủng vi khuẩn E. ictaluri Chủng vi khuẩn có độc lực cao nhất 102 CFU/cá 103 CFU/cá 104 CFU/cá 105 CFU/cá 103 CFU/cá 104 CFU/cá 105 CFU/cá 106 CFU/cá 102 CFU/cá Đối chứng Đối chứng NaCl 0,85% 106 CFU/cá Chủng vi khuẩn có độc lực cao nhất Thí nghiệm cảm nhiễm kép Quan sát thí nghiệm: thời gian vi khuẩn gây bệnh, dấu hiệu bệnh lý, tỷ lệ cá chết, đặc điểm mô bệnh học, tái phân lập và định danh vi khuẩn. Đối chứng Tiêm cùng lúc 4A3 và 1ED3 Tiêm 4A3 sau 24 giờ tiêm 1ED3 Tiêm 4A3 sau 72 giờ tiêm 1ED3 Tiêm 4A3 sau 48 giờ tiêm 1ED3 Đối chứng NaCl 0,85% 1ED3 (106 CFU/mL) 1ED3 (106 CFU/mL) + 4A3 (105 CFU/mL) Đối chứng Đối chứng NaCl 0,85% Tiêm 1ED3 sau 12 giờ tiêm 4A3 Cảm nhiễm kép bằng phương pháp ngâm Cảm nhiễm kép bằng phương pháp tiêm 4A3 (105 CFU/mL)52 3.3.5 Xác định tính nhạy cảm kháng sinh của các chủng vi khuẩn E. ictaluri và vi khuẩn A. hydrophila 3.3.5.1 Phương pháp thực hiện kháng sinh đồ Tính nhạy cảm kháng sinh của vi khuẩn E. ictaluri và A. hydrophila được xác định bằng phương pháp đĩa khuếch tán (disk diffusion assay) của Kirby-Bauer (Bauer et al., 1966) trên môi trường thạch TSA/MHA dựa theo tiêu chuẩn của Clinical and Laboratory Standards Institute (CLSI, 2012). Trong nghiên cứu này, 15 loại kháng sinh được chọn để thực hiện kháng sinh đồ với tất cả các chủng của 2 loài vi khuẩn trên gồm: amoxicillin (AMO/10 µg), ampicillin (AMP/10 µg), cefotaxime (CTX/30 µg), cefalexin (CFL/30 µg), chloramphenicol (CHL/30 µg), florfenicol (FFC/30 µg), ciprofloxacin (CIP/5 µg), enrofloxacin (ENR/5 µg), norfloxacin (NOR/5 µg), doxycycline (DOX/30 µg), tetracycline (TET/30 µg), gentamicin (GEN/10 µg), streptomycin (STR/10 µg), neomycin (NEO/30 µg) và trimethoprim/sulfamethoxazole (SXT/1,25/23,75 µg) (Oxoid, Anh). Các bước tiến hành thí nghiệm như sau: Chuẩn bị dịch huyền phù vi khuẩn: dùng que cấy tiệt trùng lấy khuẩn lạc cho vào ống nghiệm chứa 5 mL nước muối sinh lý NaCl 0,85% đã tiệt trùng. Trộn đều và so sánh độ đục với ống McFarland số 3 (9,7 mL H2SO4 1% và 0,3 mL 1% BaCl2). Nếu độ đục ngang bằng với ống chuẩn McFarland thì mật số vi khuẩn trong ống nghiệm khoảng 9x108 CFU/mL. Dùng pipet tiệt trùng hút lần lượt 0,1 mL dung dịch vi khuẩn cho lên môi trường thạch TSA và trãi đều vi khuẩn đến vừa khô. Để yên khoảng 1 phút rồi dùng pel tiệt trùng lấy đĩa kháng sinh đặt vào đĩa petri sao cho khoảng cách giữa 2 tâm của đĩa thuốc kháng sinh khoảng 24 mm và khoảng cách giữa tâm đĩa kháng sinh với mép đĩa petri khoảng 10-15 mm. Mỗi đĩa thạch dán tối đa 6 đĩa kháng sinh. Sau khi hoàn tất việc dán đĩa thuốc kháng sinh thì đặt đĩa vào tủ ấm ở 28-30ºC. Đọc kết quả: sau 24-48 giờ, trên bề mặt đĩa thạch xuất hiện các vòng tròn không có vi khuẩn phát triển (vòng vô khuẩn). Đo đường kính vòng vô khuẩn và dựa theo tiêu chuẩn của Clinical and Laboratory Standards Institute (CLSI, 2012) để xác định tính kháng (resistant, R), nhạy trung bình (intermediate, I) và nhạy cảm (susceptible, S) của vi khuẩn đối với các loại kháng sinh (Phụ lục H). 3.3.5.2 Chỉ số đa kháng MAR (multiple antibiotic resistance index) Chỉ số đa kháng của 2 loài vi khuẩn ở các tỉnh được xác định dựa trên công thức của Krumperman (1983). Công thức xác định chỉ số đa kháng (MAR) được tính như sau: MAR = X/(Y x Z), trong đó: X = tổng số kháng sinh vi khuẩn53 kháng ở mỗi tỉnh; Y = tổng số kháng sinh sử dụng trong nghiên cứu và Z = tổng số chủng vi khuẩn ở mỗi tỉnh. Giá trị MAR > 0,2 cho thấy kháng sinh được sử dụng thường xuyên, còn giá trị MAR ≤ 0,2 cho thấy kháng sinh ít hoặc không bao giờ được sử dụng trong ao nuôi cá tra. 3.3.6 Xác định các đặc điểm phân tử liên quan đến sự đa kháng thuốc ở 2 loài vi khuẩn E. ictaluri và A. hydrophila 3.3.6.1 Khảo sát sự hiện diện của các integron nhóm 1, 2 và 3 Các integron nhóm 1, 2 và 3 ở 2 loài vi khuẩn E. ictaluri và A. hydrophila trong nghiên cứu này được xác định bằng 3 cặp mồi sau: cặp mồi Int1F/Int1R (Koeleman et al., 2001) mã hóa cho gen integrase của các integron 1 (IntI1), cặp mồi RB201/RB202 (Barlow et al., 2004) mã hóa gen integrase của các integron 2 (IntI2) và cặp mồi Int3F/Int3R (Mazel et al., 2000) mã hóa gen integrase của các integron 3 (IntI3) (Bảng 3.2 và Hình 3.4). Thành phần phản ứng PCR chung để phát hiện 3 nhóm integron trên gồm: dịch đệm 1X PCR; 2,5 mM MgCl2; 20 mM dNTPs; 2U Taq DNA polymerase; 10 pmol mồi xuôi (Int1F/RB201/Int3F); 10 pmol mồi ngược (Int1R/RB202/Int3R); DMSO (1%) và 20-40 ng ADN mẫu vi khuẩn E. ictaluri/A. hydrophila. Chu kỳ và các điều kiện khuếch đại các gen IntI1, IntI2 và IntI3 được thực hiện như Bảng 3.2. Sản phẩm PCR được khuếch đại với cặp mồi Int1F/Int1R, RB201/RB202 và Int3F/Int3R có kích thước lần lượt là 160, 393 và 979 bp. Việc xác định các integron nhóm 1, 2 và 3 được thực hiện ở vi khuẩn E. ictaluri và A. hydrophila với số chủng lần lượt là n= 67 và n= 74. Ngoài ra, gen integrase của các integron 1 cũng được xác nhận lại bằng giải trình tự gen với số mẫu được chọn là n= 6 (gồm 3 mẫu từ vi khuẩn E. ictaluri và 3 mẫu từ vi khuẩn A. hydrophila), trong khi đó các gen integrase của các integron 2 và 3 âm tính nên không có sản phẩm PCR để gửi mẫu giải trình tự. 3.3.6.2 Khảo sát và giải trình tự vùng gen cassette của các integron nhóm 1 và 2 Để khuếch đại vùng gen cassette của các integron nhóm 1, nghiên cứu sử dụng cặp mồi Hep58/Hep59 của Lévesque et al. (1995). Trong khi đó, cặp mồi Hep 74/Hep 51 (White et al., 2000) được sử dụng để khuếch đại vùng gen cassette của các integron nhóm 2. Trình tự nucleotide của 2 cặp mồi, chu kỳ và các điều kiện thực hiện phản ứng PCR được trình bày chi tiết ở Bảng 3.2. Vị trí khuếch đại các vùng gen cassette trên các integron nhóm 1 và 2 được thể hiện ở Hình 3.4. Thành phần phản ứng PCR chung để phát hiện vùng gen cassette của các integron nhóm 1 và 2 trên gồm: dịch đệm 1X PCR; 2,5 mM MgCl2; 20 mM dNTPs; 2U Taq DNA polymerase; 20 pmol mồi xuôi (Hep58/Hep 74); 20 pmol54 mồi ngược (Hep59/Hep 51); DMSO (1%) và ADN mẫu vi khuẩn E. ictaluri và A. hydrophila. Tất cả các chủng vi khuẩn E. ictaluri và A. hydrophila dương tính với các integron nhóm 1 và 2 sẽ được chọn để khảo sát vùng gen cassette, trong khi đó vùng gen cassette của các integron nhóm 3 thì cho đến nay chưa có tài liệu nào đề cập đến). Ngoài ra, tất cả sản phẩm PCR khuếch đại vùng gen cassette (n= 54) sẽ được giải trình tự và so sánh với trình tự trên ngân hàng NCBI để xác định sự hiện diện của các gen cassette chèn vào các integron nhóm 1 và 2. 3.3.6.3 Khảo sát vùng 3’-CS của các integron nhóm 1 Các cặp mồi qac-F/qac-R khuếch đại gen qacEΔ1 và cặp mồi Sul1-F/Sul1-R khuếch đại gen sul1 nằm ở vùng 3’-CS của các integron nhóm 1 được khuếch đại bằng kỹ thuật PCR (Mazel et al., 2000). Ngoài ra, các gen kháng sulfonamide khác như gen sul2 (liên kết vùng 3’-CS của các integron nhóm 1) (Maynard et al., 2003) và gen sul3 (thường liên kết với các integron nhóm 1 mà không có vùng 3’-CS) (Perreten and Boerlin, 2003) cũng được khảo sát trong nghiên cứu này (Bảng 3.2). Trình tự nucleotide và chu kỳ thực hiện phản ứng PCR của các cặp mồi trên được trình bày chi tiết ở Bảng 3.2. Thành phần phản ứng PCR chung để phát hiện các gen qacEΔ1, sul1, sul2 và sul3 gồm: dịch đệm 1X PCR; 2,5 mM MgCl2; 20 mM dNTPs; 2U Taq DNA polymerase; 10-20 pmol mồi xuôi (qac-F/Sul1-F/ Sul2-F/Sul3-F); 10-20 pmol mồi ngược (qac-R/Sul1-R/ Sul2-R/Sul3-R); DMSO (1%) và ADN mẫu vi khuẩn E. ictaluri và A. hydrophila. Tất cả các chủng vi khuẩn E. ictaluri và A. hydrophila dương tính với các integron nhóm 1 (n=62) sẽ được chọn để khảo sát gen qacEΔ1, gen sul1 và gen sul2. Trong khi đó, các gen sul3 chỉ được khảo sát từ các chủng vi khuẩn dương tính với các integron nhóm 1 mà không có vùng 3’-CS (n=20). Ngoài ra, sản phẩm PCR của các gen này cũng được xác nhận lại bằng giải trình tự với số lượng như sau: gen qacEΔ1 4 mẫu (2 mẫu từ vi khuẩn E. ictaluri và 2 mẫu từ vi khuẩn A. hydrophila), gen sul1 4 mẫu (2 mẫu từ vi khuẩn E. ictaluri và 2 mẫu từ vi khuẩn A. hydrophila), gen sul2 4 mẫu (2 mẫu từ vi khuẩn E. ictaluri và 2 mẫu từ vi khuẩn A. hydrophila) và gen sul3 4 mẫu (2 mẫu từ vi khuẩn E. ictaluri và 2 mẫu từ vi khuẩn A. hydrophila). 3.3.6.4 Sự hiện diện của các plasmid kháng thuốc ở vi khuẩn E. ictaluri và A. hydrophila Các ADN plasmid của vi khuẩn E. ictaluri (n= 24) và A. hydrophila (n= 38) dương tính với các integron nhóm 1 được trích bằng bộ kít thương mại ISOLATE II Plasmid Mini Kit (Bioline, Anh). Các bước thực hiện dựa theo hướng dẫn của nhà sản xuất (Phụ lục I). ADN plasmid của vi khuẩn sau khi ly trích sẽ được điện di trên gel agarose 0,7% trong thời gian 3-4 giờ. Dựa vào thang chuẩn55 HyperLadderTM 1kb (kích thước dao động từ 0,2 kbp đến 10 kbp) để ước lượng kích thước các ADN plasmid vi khuẩn trong nghiên cứu. Hình 3.4: Sơ đồ minh họa vị trí khuếch đại 1 số gen trên các integron nhóm 1 và 2. 3.3.6.5 Khảo sát sự hiện diện của 1 số gen kháng thuốc ở 2 loài vi khuẩn Mười hai loại gen kháng tetracycline (tet gene, bao gồm tetA, tetB, tetC, tetD, tetE, tetG, tetK, tetL, tetM, tetO, tetS và tet34) đại diện cho các cơ chế kháng tetracycline khác nhau của vi khuẩn được sử dụng trong nghiên cứu này để xác định sự hiện diện của các gen kháng tetracycline từ các chủng vi khuẩn E. ictaluri và A. hydrophila. Nghiên cứu chọn ngẫu nhiên 40 chủng vi khuẩn A. hydrophila (gồm 38 chủng dương tính với các integron nhóm 1) và 40 chủng E. ictaluri (bao gồm 24 chủng dương tính với các integron nhóm 1) có kiểu hình kháng tetracyline để xác định các gen kháng tetracycline. Bên cạnh đó, 1 số gen tet của 2 loài vi khuẩn sau khi thực hiện PCR được xác nhận lại bằng cách giải trình với số lượng như sau: gen tetA (n=4), tetB (n=4), tetC (n=4), tetG (n=4), tetK (n=4) và tetS (n=4). Mỗi loại gen tet trên được chọn từ 2 chủng vi khuẩn E. ictaluri và A. hydrophila khi có kết quả dương tính. Ngoài ra, đề tài cũng xác định sự hiện diện của các gen kháng florfenicol (floR gene) thuộc nhóm phenicol ở 2 loài vi khuẩn E. ictaluri (n= 40) và A. hydrophila (n= 40). Một số chủng vi khuẩn dương tính với gen floR (E. ictaluri, n= 2 và A. hydrophila, n= 2) cũng được chọn để giải trình tự nhằm xác nhận lại tính chính xác của kết quả PCR. Bảng 3.3 và Bảng 3.4 trình bày trình tự các đoạn mồi, điều kiện phản ứng PCR và IntI1 Gen cassette sul1 qacE∆1 orf5 IntI2 Gen cassette Hep58 Hep59 Sul1R Sul1F Qac-R Qac-F Int1F Int1R Vùng kích thước biến đổi (variable region) RB202 Vùng 3’-CS Vùng 5’-CS attI attC RB201 Hep74 Hep51 Vùng 5’-CS Vùng kích thước biến đổi attI2 attC56 thành phần phản ứng PCR chung dùng để xác định 1 số gen kháng tetracycline và florfenicol của vi khuẩn E. ictaluri và A. hydrophila. Do trong nội dung nghiên cứu này có nhiều gen tet cần xác định nên không trình bày chi tiết thành phần phản ứng PCR cho từng gen. 3.3.6.6 Khảo sát khả năng tiếp hợp và truyền gen kháng thuốc của vi khuẩn E. ictaluri và A. hydrophila với vi khuẩn E. coli Hai chủng vi khuẩn E. ictaluri (chủng 1ED3 và 2ED4) và 2 chủng A. hydrophila (chủng 1A3 và 1A4) được chọn từ các chủng vi khuẩn có kiểu hình kháng tetracycline đóng vai trò như là chủng cho (donor) gen kháng thuốc để thực hiện thí nghiệm tiếp hợp với vi khuẩn E. coli (chủng ECR2 và ECR8) nhạy với kháng sinh tetracycline đóng vai trò như chủng nhận (recipient) gen kháng thuốc. Thí nghiệm khảo sát khả năng tiếp hợp và trao đổi gen kháng thuốc giữa 2 loài vi khuẩn E. ictaluri và A. hydrophila với vi khuẩn E. coli được thực hiện trong môi trường lỏng dựa theo phương pháp của các tác giả Sorum et al. (2003) và Van et al. (2007), có hiệu chỉnh. Các bước tiến hành thí nghiệm như sau: tăng sinh chủng vi khuẩn cho gen kháng thuốc và chủng vi khuẩn nhận gen kháng thuốc trên môi trường BHIB (riêng chủng vi khuẩn kháng thuốc nuôi trong môi trường có bổ sung kháng sinh thích hợp) và ủ qua đêm. Sau đó, hút 1 mL môi trường nuôi vi khuẩn cho gen kháng thuốc trộn với 1 mL môi trường nuôi chủng vi khuẩn nhận gen kháng thuốc trong 10 mL môi trường nuôi, ủ từ 12-24 giờ. Sau đó, pha loãng hỗn hợp vi khuẩn thành các nồng độ 101 đến 106, ở mỗi nồng độ hút 100 mL trãi lên đĩa môi trường MCK được bổ sung kháng sinh tetracycline (16 µg/mL) như là 1 chỉ thị chọn lọc vi khuẩn sau khi tiếp hợp. Các khuẩn lạc vi khuẩn E. coli nhận gen kháng thuốc sau khi tiếp hợp (transconjugant) được chọn lọc từ môi trường có bổ sung kháng sinh tetracycline sẽ được kiểm tra lại kháng sinh đồ, sự hiện diện của các plasmid, các integron nhóm 1 và các gen kháng thuốc kháng sinh. 3.3.6.7 Nghiên cứu khả năng tiếp hợp và truyền gen kháng thuốc giữa vi khuẩn E. ictaluri và A. hydrophila Tương tự, khả năng tiếp hợp và truyền gen kháng thuốc giữa các chủng vi khuẩn E. ictaluri và A. hydrophila cũng được thực hiện trong môi trường lỏng theo phương pháp trình bày như trên. Trong thí nghiệm này, chọn 3 chủng A. hydrophila (27A3, 6A4 và 20A4) nhạy với tetracycline cho tiếp hợp lần lượt với 2 chủng E. ictaluri (chủng 1ED3 và 2ED4) kháng với tetracycline, ngược lại 2 chủng E. ictaluri (chủng 9ED3 và 11ED3) nhạy với tetracycline cho tiếp hợp lần lượt với 2 chủng A. hydrophila (chủng 1A3 và 2A4) kháng với tetracycline.57 Bảng 3.2: Trình tự các cặp mồi dùng để phát hiện các integron nhóm 1, 2 và 3 Tên mồi Gen mục tiêu Trình tự mồi (5’→ 3’) Kích thước (bp) Chu kỳ và điều kiện phản ứng Tác giả Int1F Int1R integron 1 CAG TGG ACA TAA GCC TGT TC CCC GAG GCA TAG ACT GTA 160 94oC-30 giây, 55oC-30 giây, 72oC-30 giây (35 chu kỳ) Koeleman et al. (2001) RB201 RB202 integron 2 GCA AAC GCA AGC ATT CAT TA ACG GAT ATG CGA CAA AAA GG 393 94oC-30 giây, 62oC-30 giây, 72oC-45 giây (30 chu kỳ) Barlow et al. (2004) Int3F Int3R integron 3 GCC TCC GGC AGC GAC TTT CAG ACG GAT CTG CCA AAC CTG ACT 979 94oC-30 giây, 62oC-30 giây, 72oC-60 giây (30 chu kỳ) Mazel et al. (2000) Hep58 Hep59 array class 1 GGC ATC CAA GCA GCA AG AAG CAG ACT TGA CCT GA Variable* 94oC-1 phút, 55oC-1 phút, 72oC-5 phút (35 chu kỳ) Lévesque et al. (1995) Hep 74 Hep 51 array class 2 CGGGATCCCGGACGGCATGCACGATTTGTA GAT GCC ATC GCA AGT ACG AG Variable* 94oC-1 phút, 55oC-1 phút, 72oC-5 phút (35 chu kỳ) White et al. (2000) Qac-F Qac-R Gen qacEΔ1 GGC TGG CTT TTT CTT GTT ATC G TGA GCC CCA TAC CTA CAA AGC 287 94oC-30 giây, 56oC-30 giây, 72oC-60 giây (30 chu kỳ) Mazel et al. (2000) Sul1-F Sul1-R Sul1 TGG TGA CGG TGT TCG GCA TTC GCG AGG GTT TCC GAG AAG GTG 789 94oC-30 giây, 60oC-30 giây, 72oC-30 giây (30 chu kỳ) Mazel et al. (2000) Sul2-F Sul2-R Sul2 CGG CAT CGT CAA CAT AAC C GTG TGC GGA TGA AGT CAG 722 94oC-1 phút, 50oC-1 phút, 72oC-5 phút (35 chu kỳ) Maynard et al. (2003) Sul3-F Sul3-R Sul3 GAG CAA GAT TTT TGG AAT CG CAT CTG CAG CTA ACC TAG GGC TTT GGA 790 94oC-1 phút, 55oC-1 phút, 72oC-5 phút (30 chu kỳ) Perreten and Boerlin (2003) * Kích thước sản phẩm thay đổi tùy thuộc các gen cassette chèn vào.58 Bảng 3.3: Các đoạn mồi và điều kiện phản ứng PCR xác định các gen kháng tetracycline và florfenicol ở vi khuẩn E. ictaluri và A. hydrophila Tên mồi Gen mục tiêu Trình tự mồi (5’→ 3’) Kích thước (bp) Điều kiện và chu kỳ phản ứng PCR Tác giả tetA (F) tetA (R) tetA GTA ATT CTG AGC ACT GTC GC CTG CCT GGA CAA CAT TGC TT 957 95oC-30 giây, 62oC-30 giây, 72oC-45 giây (23 chu kỳ). Schmidt et al. (2001a) tetB (F) tetB (R) tetB CTC AGT ATT CCA AGC CTT TG CTA AGC ACT TGT CTC CTG TT 436 95oC-30 giây, 59oC-30 giây, 72oC-20 giây (25 chu kỳ). Schmidt et al. (2001a) tetC (F) tetC (R) tetC TCT AAC AAT GCG CTC ATC GT GGT TGA AGG CTC TCA AGG GC 589 95oC-30 giây, 62oC-30 giây, 72oC-30 giây (30 chu kỳ). Schmidt et al. (2001a) tetD (F) tetD (R) tetD ATT ACA CTG CTG GAC GCG AT CTG ATC AGC AGA CAG ATT GC 1.124 95oC-30 giây, 59oC-30 giây, 72oC-20 giây (25 chu kỳ) Schmidt et al. (2001a) tetE (F) tetE (R) tetE GTG ATG ATG GCA CTG GTC AT CTC TGC TGT ACA TCG CTC TT 1.268 95oC-30 giây, 62oC-30 giây, 72oC-45 giây (23 chu kỳ). Schmidt et al. (2001a) tetG (F) tetG (R) tetG TTC AAG CCG GCT TGG AGA G TTG TTT GAG AGC ATT GCC TGC 645 95oC-1 phút, 56oC-1 phút, 72oC-2 phút (30 chu kỳ). Stanton and Humphrey (2003) tetK (F) tetK (R) tetK TTA GGT GAA GGG TTA GGT CC GCA AAC TCA TTC CAG AAG CA 718 95oC-1 phút, 55oC-1 phút, 72oC-1,30 phút (25 chu kỳ). Aarestrup et al. (2000) tetL (F) tetL (R) tetL CAT TTG GTC TTA TTG GAT CG ATT ACA CTT CCG ATT TCG G 488 95oC-1 phút, 55oC-1 phút, 72oC-1,30 phút (25 chu kỳ). Aarestrup et al. (2000) tetM (F) tetM (R) tetM GTT AAA TAG TGT TCT TGG AG CTA AGA TAT GGC TCT AAC AA 657 95oC-30 giây, 55oC-30 giây, 72oC-1,30 phút (30 chu kỳ). Aarestrup et al. (2000) tetO (F) tetO (R) tetO GAT GGC ATA CAG GCA CAG AC CAA TAT CAC CAG AGC AGG CT 614 95oC-1 phút, 60oC-1 phút, 72oC-1,30 phút (25 chu kỳ). Aarestrup et al. (2000) tetS (F) tetS (R) tetS TGG AAC GCC AGA GAG GTA TT ACA TAG ACA AGC CGT TGA CC 660 95oC-30 giây, 55oC-30 giây, 72oC-1,30 phút (30 chu kỳ). Aarestrup et al. (2000) tet34 (F) tet34 (R) tet34 ATG AAA ACG AAC GCT AAT TAA CCA ACA TAG AGA TCG ATG CTA GTA CTA 465 95oC-1 phút, 56oC-1 phút, 72oC-2 phút (30 chu kỳ). Midranda et al. (2003) floRF floRR floR TCA CGG GCC ACG CTG TAT C CGC CGT CAT TCT TCA CCT TC 215 96oC-15 giây, 52oC-30 giây, 70oC-1 phút (30 chu kỳ). Bolton et al. (1999); Fernández-Alarcón et al. (2010)59 3.3.7 Thành phần chung cho các phản ứng PCR trong nghiên cứu Thành phần các hóa chất chung thực hiện phản ứng PCR để định danh vi khuẩn, khảo sát các integron nhóm 1, 2 và 3, các gen kháng tetracycline và florfenicol của 2 loài vi khuẩn E. ictaluri và A. hydrophila được trình bày ở Bảng 3.4. Bảng 3.4: Thành phần các hóa chất chung để thực hiện phản ứng PCR TT Thành phần Nồng độ thực hiện Thể tích 1 Nước cất - 11,75 2 Dung dịch đệm PCR 1X 2,5 3 MgCl2 2,5 mM 2,0 4 dNTPs 10-20 mM 4,0 5 Mồi xuôi 10-20 pmol 1,0 6 Mồi ngược 10-20 pmol 1,0 7 Taq ADN polymerase 1,5-2,5U Taq 0,25 8 DMSO 1% 0,5 9 ADN mẫu 20-60 ng 2,0 Tổng - 25 µL 3.3.8 Phương pháp phân tích và xử lý số liệu Tỷ lệ tương đồng của các chủng vi khuẩn E. ictaluri và A. hydrophila phân lập từ cá tra bệnh gan thận mủ và xuất huyết được so sánh với các chủng trên ngân hàng GenBank bằng chương trình BLAST (www.ncbi.nlm.nih.gov/BLAST/). Các số liệu và đồ thị trong thí nghiệm được nhập và xử lý bằng phần mềm Microsoft Excel 2010. Sử dụng phương pháp thống kê mô tả để tính toán các giá trị trung bình và tỷ lệ % vi khuẩn kháng, nhạy và nhạy trung bình. Sự khác biệt về độc lực gây bệnh trên cá tra của các chủng vi khuẩn E. ictaluri và A. hydrophila trong các NT thí nghiệm cảm nhiễm đơn và cảm nhiễm kép được phân tích ANOVA bằng phần mềm SPSS 11.5 ở mức ý nghĩa 5%.60 Chương IV. KẾT QUẢ VÀ THẢO LUẬN 4.1 Kết quả phân lập và định danh vi khuẩn 4.1.1 Kết quả phân lập và định danh vi khuẩn E. ictaluri 4.1.1.1 Kết quả phân lập vi khuẩn E. ictaluri Từ 125 mẫu cá tra bệnh (gồm 90 mẫu cá bệnh GTM và 35 mẫu cá có dấu hiệu 2 loại bệnh GTM và bệnh XH) thu ở 50 ao nuôi cá tra thâm canh ở 1 số tỉnh ĐBSCL (Phụ lục B), đề tài đã phân lập được 67 chủng vi khuẩn E. ictaluri trên môi trường TSA, gồm 15 chủng ở Đồng Tháp (chiếm 22,39%), 7 chủng ở An Giang (chiếm 10,45%), 8 chủng ở Tp. Cần Thơ (chiếm 11,94%), 8 chủng ở Vĩnh Long (chiếm 11,94%), 12 chủng ở Tiền Giang (chiếm 17,91%), 8 chủng ở Trà Vinh (chiếm 11,94%) và 9 chủng ở Bến Tre (chiếm 13,43%). Nhìn chung, hầu hết các chủng vi khuẩn đều được phân lập từ các cơ quan như gan (30/67 chủng, chiếm 44,78%), thận (19/67 chủng, chiếm 28,36%) và tỳ tạng (18/67 chủng, chiếm 26,87%) của cá tra nhiễm bệnh (Bảng 4.1). Ngoài ra, trong số 67 vi khuẩn E. ictaluri phân lập được thì có 45/67 (chiếm 67,16%) chủng phân lập từ cá tra bệnh GTM và 22/67 (chiếm 32,84%) chủng phân lập từ cá tra nhiễm kép 2 bệnh GTM và bệnh XH. Kết quả phân lập và nguồn gốc của các chủng vi khuẩn E. ictaluri được trình bày chi tiết ở Phụ lục J1. Bảng 4.1: Số chủng vi khuẩn E. ictaluri phân lập từ cá tra bệnh GTM hoặc cá nhiễm kép bệnh XH và GTM ở 1 số tỉnh ĐBSCL TT Địa điểm thu mẫu Số mẫu cá (con) Số chủng E. ictaluri Cơ quan phân lập* 2013 2014 1 Đồng Tháp 24 5 10 Gan (6), thận (4), tỳ tạng (5) 2 An Giang 14 5 2 Gan (1), thận (3), tỳ tạng (3) 3 Tp. Cần Thơ 14 2 6 Gan (5), thận (2), tỳ tạng (1) 4 Vĩnh Long 14 4 4 Gan (3), thận (2), tỳ tạng (3) 5 Tiền Giang 22 8 4 Gan (7), thận (2), tỳ tạng (3) 6 Trà Vinh 20 2 6 Gan (4), thận (3), tỳ tạng (1) 7 Bến Tre 17 4 5 Gan (4), thận (3), tỳ tạng (2) Tổng 125 30 37 Gan (30), thận (19), tỳ tạng (18) * Các số trong dấu ngoặc là số chủng vi khuẩn E. ictaluri phân lập từ cơ quan cá bệnh GTM và cá nhiễm kép 2 bệnh GTM và XH. 4.1.1.2 Đặc điểm hình thái, sinh lý và sinh hóa các chủng vi khuẩn E. ictaluri phân lập được Kết quả kiểm tra các đặc điểm về hình thái, sinh lý và sinh hóa cơ bản của vi khuẩn cho thấy sau 36-48 giờ phát triển trên môi trường TSA, khuẩn lạc của tất cả các chủng vi khuẩn E. ictaluri phân lập được đều có màu trắng đục, hơi tròn,61 độ nổi mô, đa phần khuẩn lạc vi khuẩn nhỏ li ti (đường kính thường <1,0 mm) (Hình 4.1A). Kết quả nhuộm Gram và chụp SEM cho thấy vi khuẩn thuộc nhóm Gram âm và có dạng hình que dài (Hình 4.1B&C). Vi khuẩn E. ictaluri có khả năng di động nhưng di động yếu. Vi khuẩn cho phản ứng oxidase âm tính, catalase dương tính, có khả năng oxid hóa và lên men đường glucose trong cả 2 điều kiện hiếu khí và yếm khí (Hình 4.1D). Tất cả các chủng vi khuẩn có thể phát triển trên môi trường có nồng độ muối từ 0,5 đến 1,5% nhưng không thể phát triển ở nồng độ muối 2% trở lên. Ngoài ra, kết quả khảo sát hoạt tính tan huyết của vi khuẩn cho thấy 57/64 chủng vi khuẩn phân lập được (chiếm 89,06%) có khả năng tan huyết dạng β trên môi trường thạch máu (BA) có bổ sung 5% máu cừu và 7/64 (chiếm 10,94%) chủng vi khuẩn còn lại không gây tan huyết trên môi trường thạch máu (tan huyết dạng γ). Hình 4.1: Đặc điểm hình thái, sinh lý và sinh hóa cơ bản của các chủng vi khuẩn E. ictaluri phân lập từ cá tra bệnh GTM ở ĐBSCL. A. Khuẩn lạc vi khuẩn E. ictaluri phát triển trên môi trường TSA sau 48 giờ ủ ở 28oC. B. Ảnh nhuộm Gram vi khuẩn (100X). C. Ảnh chụp vi khuẩn E. ictaluri (chủng 1ED3) dưới kính hiển vi điện tử quét (độ phóng đại 6.000X). D. Kết quả phản ứng oxid hóa và lên men đường glucose. Như vậy, các đặc điểm về hình thái khuẩn lạc, sinh lý và sinh hóa cơ bản của 67 chủng vi khuẩn phân lập được trong nghiên cứu này phù hợp với đặc điểm của A B C D62 vi khuẩn E. ictaluri đã được nghiên cứu bởi nhiều tác giả trong và ngoài nước (Waltman et al., 1986; Yuasa et al., 2003; Từ Thanh Dung và ctv., 2004; Nguyễn Hữu Thịnh và Trương Thanh Loan, 2007; Crumlish et al., 2010). Tuy nhiên, 1 số nghiên cứu cho thấy vi khuẩn E. ictaluri sẽ có hình dạng và màu sắc khác nhau khi chúng phát triển trên các môi trường dinh dưỡng khác nhau. Kết quả nghiên cứu của Nguyễn Hữu Thịnh và Trương Thanh Loan (2007) cho thấy trên môi trường BHI ủ ở 30oC sau 24 giờ thì khuẩn lạc vi khuẩn trong suốt và nhỏ li ti. Tuy nhiên, khuẩn lạc sẽ phát triển rõ hơn, có màu trắng hơi trong, lồi, tròn với đường kính là 0,5-2 mm sau 48 giờ ủ. Theo Trần Thị Thanh Huyền và ctv. (2011) khuẩn lạc vi khuẩn E. ictaluri phân lập trên môi trường chọn lọc EIM (Edwardsiella ictaluri medium) sẽ có màu xanh, tròn đều và đường kính 0,2-0,5 mm. Trong khi đó, kết quả phân lập của Dung et al. (2008) cho thấy trên môi trường TSA khuẩn lạc vi khuẩn E. ictaluri có màu trắng đục, không có nhân, rìa có dạng không đồng nhất. 4.1.1.3 Định danh các chủng vi khuẩn E. ictaluri phân lập được Nghhiên cứu tiến hành định danh 6 chủng vi khuẩn E. ictaluri bằng bộ kít API 20E (Hình 4.2). Kết quả định danh vi khuẩn E. ictaluri bằng bộ kít API 20E cùng với các đặc điểm về hình thái khuẩn lạc, sinh hóa vi khuẩn được trình bày chi tiết ở Bảng 4.2. Qua kết quả từ Bảng 4.2 và Hình 4.2 cho thấy 6 chủng vi khuẩn kiểm tra đa phần (17/20 chỉ tiêu) cho phản ứng âm tính với các chỉ tiêu như orthonitrophenyl galactosidase, arginine, ornithine, citrate, H2S, urease, tryptophane deaminase, indole, gelatin, mannitol, inositol, sorbitol, rhamnose, saccharose, melibiose, amygdalin và arabinose. Trong khi đó, các chủng vi khuẩn chỉ cho 3/20 phản ứng dương tính với lysine, Voges-Proskauer và glucose. ONPG ADH LDC ODC CIT H2S URE TDA IND VP - - + - - - - - - + GEL GLU MAN INO SOR RHA SAC MEL AMY ARA - + - - - - - - - - Hình 4.2: Kết quả định danh vi khuẩn E. ictaluri phân lập được bằng bộ kít API 20E.63 Qua kết quả Hình 4.2 cho thấy 6 chủng vi khuẩn kiểm tra đều không sinh H2S và indole. Đây là 2 chỉ tiêu sinh hóa quan trọng để phân biệt 2 loài vi khuẩn E. ictaluri và E. tarda của giống Edwardsiella, trong khi vi khuẩn E. tarda cho phản ứng dương tính với indole và H2S thì vi khuẩn E. ictaluri cho phản ứng indole và H2S âm tính (Abbott and Janda, 2010). Như vậy, các đặc điểm sinh lý và sinh hóa của các chủng vi khuẩn phân lập được trong nghiên cứu phù hợp với các đặc điểm vi khuẩn E. ictaluri đã được mô tả trước đây của nhiều tác giả trong và ngoài nước (Shotts and Walman, 1986; Waltman et al., 1986; Crumlish et al., 2002; Keskin et al., 2004; Nguyễn Quốc Thịnh và Từ Thanh Dung, 2004; Nguyễn Hữu Thịnh và Trương Thanh Loan, 2007). Nhìn chung, các đặc điểm về hình thái, sinh lý và sinh hóa của các chủng vi khuẩn E. ictaluri được phân lập từ các vùng địa lý khác nhau trong các nghiên cứu trước đây và trong nghiên cứu này rất đồng dạng, hầu như không có sự khác biệt giữa các chủng khi được kiểm tra (Waltman et al., 1986; Yuasa et al., 2003; Panangala et al., 2006; Bartie et al., 2012). Ngoài ra, để chính xác thì tất cả các chủng vi khuẩn còn được định danh bằng kỹ thuật PCR. Kết quả cho thấy vùng đầu nguồn của gen bám dính của 67/67 (100%) chủng vi khuẩn E. ictaluri phân lập đã được khuếch đại với vạch ADN (DNA band) xuất hiện ở kích thước khoảng 470 bp (Hình 4.3). Như vậy, kết quả PCR phù hợp với báo cáo của Sakai et al. (2009). Bên cạnh đó, sản phẩm PCR sau khi được khuếch đại được giải trình tự và so sánh với các trình tự của vi khuẩn E. ictaluri trên cơ sở dữ liệu NCBI. Kết quả cho thấy 12 chủng vi khuẩn giải trình tự trong nghiên cứu (Phụ lục K1) có tỷ lệ tương đồng cao từ 99-100% (giá trị kỳ vọng (E value) = 0) với các chủng vi khuẩn E. ictaluri trên ngân hàng GenBank là E. ictaluri chủng FPC1092 (AB469961.1), E. ictaluri chủng T3-3 (KR080261.1), E. ictaluri chủng T2-2 (KR080260.1), E. ictaluri chủng T2-1 (KR080259.1), E. ictaluri chủng T1-3 (KR080258.1), E. ictaluri chủng T1-2 (KR080257.1), E. ictaluri chủng T1-1 (KR080256.1), E. ictaluri chủng 93-146 (CP001600.2), E. ictaluri chủng JCM 1680 (AB469968.1) và E. ictaluri chủng JF0284 (AB469967.1).64 Bảng 4.2: Kết quả kiểm tra các đặc điểm về hình thái, sinh hóa và định danh vi khuẩn E. ictaluri bằng bộ kít API 20E Các đặc điểm vi khuẩn 1ED3 3ED3 8ED3 10ED3 1ED4 6ED4 Chủng E. ictaluri* tham khảo Gram - - - - - - - Hình dạng Que dài Que dài Que dài Que dài Que dài Que dài Que dài Di động Yếu Yếu Yếu Yếu Yếu Yếu Yếu Oxidase - - - - - - - Catalase + + + + + + + Phản ứng O/F +/+ +/+ +/+ +/+ +/+ +/+ +/+ Phát triển trên môi trường NaCl**: 0,5% +++ +++ +++ +++ +++ +++ +++ 1% ++ ++ ++ ++ ++ ++ ++ 1,5% + + + + + + + 2% - - - - - - - Khả năng tan huyết β β β β γ β β ONPG - - - - - - - Arginine - - - - - - - Lysine + + + + + + + Ornithine - - - - - - - Citrate - - - - - - - Sinh H2S - - - - - - - Urea - - - - - - - Tryptophane deaminase - - - - - - Sinh Indol - - - - - - - Voges-Proskauer + + + + + + + Gelatin - - - - - - - Glucose + + + + + + + Mannitol - - - - - - - Inositol - - - - - - - Sorbitol - - - - - - - Rhamnose - - - - - - - Saccharose - - - - - - - Melibiose - - - - - - - Amygdalin - - - - - - - Arabinose - - - - - - - ONPG: Ortho-nitrophenyl galactosidase +: dương tính -: âm tính * Các đặc điểm vi khuẩn E. ictaluri được tổng hợp từ các nghiên cứu của Hawke et al. (1981); Waltman et al. (1986); ** Khả năng phát triển của vi khuẩn trên môi trường có các nồng độ muối khác nhau: +++: phát triến rất tốt, ++: phát triển tốt, +: yếu và -: không phát triến.65 Cho đến nay, việc sử dụng kỹ thuật PCR để định danh vi khuẩn E. ictaluri đã được báo cáo bởi nhiều tác giả trong và ngoài nước (Williams and Lawrence, 2009; Lê Hữu Thôi và ctv., 2010), Trần Nguyễn Diễm Tú và Đặng Thị Hoàng Oanh, 2012). Crumlish et al. (2002) đã sử dụng kỹ thuật PCR để phát hiện vùng đặc hiệu trên vùng gen 16S rRNA của vi khuẩn E. ictaluri với kích thước sản phẩm là 500 bp. Tương tự, Yuasa et al. (2003) cũng phát hiện vi khuẩn E. ictaluri với sản phẩm PCR là 530 bp. Đặc biệt, thời gian gần đây, Panangala et al. (2007) đã công bố nghiên cứu cho thấy việc sử dụng kỹ thuật PCR đa mồi (multiplex PCR, mPCR) có thể phát hiện đồng thời 3 loài vi khuẩn gây bệnh trên cá nheo Mỹ là E. ictaluri, A. hydrophila và F. columnare. Ở Việt Nam, các tác giả Đặng Thị Hoàng Oanh và Đặng Thụy Mai Thy (2009), Đặng Thị Hoàng Oanh và Nguyễn Trúc Phương (2010), Lê Hữu Thôi và ctv. (2010) đã sử dụng cặp mồi EiFd-1 và EiRs-1 khuếch đại vùng đặc hiệu trên đoạn gen 16S rRNA có kích thước 407 bp để phát hiện vi khuẩn E. ictaluri. Trong khi đó, Trần Thị Thanh Huyền và ctv. (2011) đã thiết kế đoạn mồi để khuếch đại đoạn gen eip 18 có kích thước khoảng 480 bp đặc trưng của vi khuẩn E. ictaluri. Hình 4.3: Phổ điện di ADN của các chủng vi khuẩn E. ictaluri phân lập được bằng kỹ thuật PCR. M: thang chuẩn 100 bp và 100 bp plus; giếng 1-13: các chủng vi khuẩn E. ictaluri được kiểm tra theo thứ tự là 1ED3, 2ED3, 3ED3, 4ED3, 5ED3, 6ED3, 7ED3, 8ED3, 9ED3, 10ED3, 11ED3, 12ED3, 13ED3; giếng 15-30: thứ tự các mẫu là 14ED3, 15ED3, 16ED3, 17ED3, 18ED3, 19ED3, 20ED3, 21ED3, 22ED3, 23ED3, 24ED3, 25ED3, 26ED3, 27ED3, 28ED3, 29ED3; giếng 14: đối chứng âm. 4.1.2 Kết quả phân lập và định danh vi khuẩn A. hydrophila 4.1.2.1 Kết quả phân lập vi khuẩn A. hydrophila Tương tự, từ các cơ quan gan, thận và tỳ tạng của 130 mẫu cá tra nhiễm bệnh (gồm 95 mẫu cá bệnh XH và 35 mẫu có dấu hiệu nhiễm kép 2 loại bệnh XH và bệnh GTM) thu ở 1 số tỉnh ĐBSCL (Phụ lục B), tổng số 74 chủng vi khuẩn A. hydrophila đã được phân lập trên môi trường TSA, gồm: 10 chủng ở Đồng Tháp (chiếm 13,51%), 8 chủng ở An Giang (chiếm 10,81%), 8 chủng ở Tp. Cần Thơ (chiếm 10,81%), 15 chủng ở Vĩnh Long (chiếm 20,27%), 12 chủng ở Tiền Giang (chiếm 16,22%), 8 chủng ở Trà Vinh (chiếm 10,81%) và 13 chủng ở Bến Tre (chiếm 17,57%). Nhìn chung, hầu hết các chủng vi khuẩn đều được phân lập từ các cơ quan như gan (38/74 chủng, chiếm 51,35%), thận (20/74 chủng, chiếm M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 M 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 470 bp66 27,03%) và tỳ tạng (16/74 chủng, chiếm 21,62%) của cá bệnh (Bảng 4.3). Ngoài ra, trong số 74 chủng vi khuẩn A. hydrophila phân lập được thì có 52/74 (chiếm 70,27%) chủng được phân lập từ cá tra bệnh XH và 22/74 (chiếm 29,73%) chủng phân lập từ cá tra nhiễm kép 2 bệnh XH và bệnh GTM. Kết quả phân lập và nguồn gốc của các chủng vi khuẩn A. hydrophila được trình bày chi tiết ở Phụ lục J2. Bảng 4.3: Số chủng vi khuẩn A. hydrophila phân lập từ cá tra bệnh XH hoặc cá nhiễm kép 2 bệnh XH và GTM ở 1 số tỉnh ĐBSCL TT Địa điểm thu mẫu Số mẫu cá (con) Số chủng A. hydrophila Cơ quan phân lập* 2013 2014 1 Đồng Tháp 20 5 5 Gan (6), thận (1), tỳ tạng (3) 2 An Giang 14 4 4 Gan (5), thận (2), tỳ tạng (1) 3 Tp. Cần Thơ 16 5 3 Gan (4), thận (3), tỳ tạng (1) 4 Vĩnh Long 18 9 6 Gan (6), thận (3), tỳ tạng (6) 5 Tiền Giang 25 7 5 Gan (6), thận (5), tỳ tạng (1) 6 Trà Vinh 21 4 4 Gan (5), thận (3) 7 Bến Tre 16 7 6 Gan (6), thận (3), tỳ tạng (4) Tổng 130 41 33 Gan (38), thận (20), tỳ tạng (16) * Các số trong dấu ngoặc là số chủng vi khuẩn A. hydrophila phân lập từ cơ quan cá bệnh XH và cá nhiễm kép 2 bệnh GTM và XH. 4.1.2.2 Đặc điểm hình thái, sinh lý và sinh hóa của các chủng vi khuẩn A. hydrophila phân lập được Tương tự, các chủng vi khuẩn A. hydrophila sau khi phân lập cũng được kiểm tra các đặc điểm về hình thái, sinh lý và sinh hóa cơ bản trước khi định danh bằng bộ kít API 20E. Kết quả cho thấy so với vi khuẩn E. ictaluri có thời gian phát triển tương đối chậm trên môi trường TSA (36-48 giờ) thì vi khuẩn A. hydrophila phát triển nhanh hơn. Sau 18-36 giờ có thể quan sát khuẩn lạc của chúng phát triển trên môi trường TSA với khuẩn lạc có dạng tròn (đường kính 1-3 mm), độ nổi hơi lồi, màu vàng nhạt đến màu vàng kem (Hình 4.4A). Tương tự vi khuẩn E. ictaluri, vi khuẩn A. hydrophila cũng thuộc nhóm Gram âm (Hình 4.4B). Tuy nhiên, vi khuẩn có dạng hình que ngắn (Hình 4.4C) và chúng có khả năng di động mạnh. Ngoài ra, vi khuẩn cho phản ứng dương tính với oxidase và catalase, có khả năng lên men đường glucose trong cả 2 điều kiện hiếu khí và yếm khí (Hình 4.4D). Tất cả các chủng vi khuẩn có thể phát triển trên môi trường có nồng độ muối từ 1 đến 4%, ở nồng độ muối 5% thì có 8/74 (chiếm 10,81%) nhưng ở nồng độ muối 6% trở lên thì không có chủng vi khuẩn nào phát triển. Ngoài ra, kết quả khảo sát hoạt tính tan huyết của vi khuẩn cho thấy 71/74 (chiếm 94,59%) chủng vi khuẩn phân lập có khả năng tan huyết dạng β trên môi trường67 thạch máu (BA) có bổ sung 5% máu cừu và 3/74 (chiếm 4,05%) chủng vi khuẩn còn lại không gây tán huyết trên môi trường thạch máu (tan huyết dạng γ). Hình 4.4: Đặc điểm hình thái, sinh lý và sinh hóa cơ bản của các chủng vi khuẩn A. hydrophila phân lập được từ cá tra bệnh XH ở ĐBSCL. A. Khuẩn lạc vi khuẩn A. hydrophila phát triển trên môi trường TSA sau 24 giờ. B. Ảnh nhuộm Gram vi khuẩn (100X). C. Ảnh chụp vi khuẩn A. hydrophila (chủng 4A3) dưới kính hiển điện tử quét (độ phóng đại 6.000X). D. Kết quả phản ứng oxid hóa và lên men đường glucose. Vi khuẩn A. hydrophila được xem là tác nhân gây bệnh cho nhiều loài cá khác nhau trên thế giới (Newman, 1993). Đặc biệt, vi khuẩn A. hydrophila được xác định là tác nhân gây bùng phát bệnh MAS trên cá nheo Mỹ (Pridgeon and Klesius, 2011; Pridgeon et al., 2013). Trên cá tra thì bệnh XH do vi khuẩn A. hydrophila từ lâu đã được nhiều tác giả đề cập đến. Như vậy, kết quả khảo sát các đặc điểm về hình thái khuẩn lạc, sinh lý và sinh hóa cơ bản của các chủng vi khuẩn A. hydrophila phân lập được từ cá nhiễm bệnh XH hoặc nhiễm kép trong nghiên cứu này tương tự với các đặc điểm về hình thái khuẩn lạc, sinh lý và sinh hóa cơ bản của các chủng vi khuẩn A. hydrophila trong các báo cáo trước đây của Ly et al., 2009; Crumlish et al., 2010), Đặng Thị Hoàng Oanh và Nguyễn Đức Hiền (2012) và Trần Thị Mỹ Hân (2013). A B C D68 4.1.2.3 Định danh các chủng vi khuẩn A. hydrophila phân lập được Sáu chủng vi khuẩn được chọn để định danh bằng bộ kít API 20E (Hình 4.5). Kết quả định danh vi khuẩn A. hydrophila bằng bộ kít API 20E cũng như dựa vào các đặc điểm về hình thái, sinh lý và sinh hóa khác được trình bày ở Bảng 4.4. Qua kết quả Bảng 4.4 và Hình 4.5 cho thấy tất cả các chủng vi khuẩn kiểm tra đều cho phản ứng âm tính với các chỉ tiêu như ornithine, citrate, H2S, urease, tryptophane deaminase, indole, inositol, sorbitol, rhamnose, melibiose và arabinose. Trong khi đó, vi khuẩn cho các phản ứng dương tính gồm: orthonitrophenyl galactosidase, arginine, lysine, Voges-Proskauer, gelatin, glucose, mannitol, saccharose và amygdalin. ONPG ADH LDC ODC CIT H2S URE TDA IND VP + + + - - - - - - + GEL GLU MAN INO SOR RHA SAC MEL AMY ARA + + + - - - + - + - Hình 4.5: Kết quả định danh vi khuẩn A. hydrophila phân lập được bằng bộ kít API 20E. Như vậy, vi khuẩn A. hydrophila trong nghiên cứu này có các đặc điểm sinh hóa tương tự với vi khuẩn A. hydrophila phân lập từ cá tra bệnh XH của Ly et al. (2009) và Crumlish et al. (2010), lươn đồng bệnh XH của Đặng Thị Hoàng Oanh và Nguyễn Đức Hiền (2012) và trên cá thát lát còm của Đặng Thụy Mai Thy và ctv. (2014). Tuy nhiên, các đặc điểm vi khuẩn A. hydrophila trong nghiên cứu này có 1 số đặc điểm khác với vi khuẩn A. hydrophila gây bệnh MAS trên cá nheo Mỹ của Pridgeon and Klesius (2011). Kết quả định danh 3 chủng vi khuẩn A. hydrophila bằng bộ kít API 20E trong nghiên cứu của Pridgeon and Klesius (2011) cho kết quả dương tính với citrate, indole, inositol, saccharose và arabinose, trong khi đó 6 chủng vi khuẩn A. hydrophila trong nghiên cứu này cho kết quả âm tính. Ngược lại, các chỉ tiêu như lysine decarboxylase và amygdalin của 3 chủng vi khuẩn A. hydrophila trong nghiên cứu của Pridgeon and Klesius (2011) âm tính thì 6 chủng vi khuẩn A. hydrophila trong nghiên cứu này lại cho kết quả dương tính.69 Bảng 4.4: Kết quả kiểm tra các đặc điểm về hình thái, sinh hóa và định danh vi khuẩn A. hydrophila phân lập được Các đặc điểm vi khuẩn 1A3 2A3 4A3 5A3 2A4 7A4 Chủng A. hydrophila* tham khảo Gram - - - - - - - Hình dạng Que ngắn Que ngắn Que ngắn Que ngắn Que ngắn Que ngắn Que ngắn Di động Chuyển động Chuyển động Chuyển động Chuyển động Chuyển động Chuyển động Chuyển động Oxidase + + + + + + + Catalase + + + + + + + Phản ứng O/F +/+ +/+ +/+ +/+ +/+ +/+ +/+ Phát triển trên môi trường NaCl** 1% +++ +++ +++ +++ +++ +++ +++ 2% +++ +++ +++ +++ +++ +++ +++ 3% +++ +++ +++ +++ +++ +++ +++ 4% ++ ++ ++ + ++ + ++ 5% + - + - + - + 6% - - - - - - - Khả năng tan huyết β β β β β β β ONPG + + + + + + + Arginine + + + + + + + Lysine + + + + + + - Ornithine - - - - - - - Citrate - - - - - - + Sinh H2S - - - - - - - Urease - - - - - - - Tryptophane deaminase - - - - - - - Sinh Indol - - - - - - + Voges-Proskauer + + + + + + + Gelatin + + + + + + + Glucose + + + + + + + Mannitol + + + + + + + Inositol - - - - - - + Sorbitol - - - - - - - Rhamnose - - - - - - - Saccharose + + + + + + + Melibiose - - - - - - - Amygdalin + + + + + + - Arabinose - - - - - - + ONPG: Orthnitrophenyl galactosidase +: dương tính -: âm tính * Các đặc điểm vi khuẩn A. hydrophila được tổng hợp từ nghiên cứu của Pridgeon and Klesius (2011); ** Khả năng phát triển của vi khuẩn trên môi trường có các nồng độ muối khác nhau: +++: phát triến rất tốt, ++: phát triển tốt, +: yếu và -: không phát triến.70 Bên cạnh đó, để xác định chính xác thì nghiên cứu cũng sử dụng kỹ thuật PCR để định danh các chủng vi khuẩn A. hydrophila phân lập được. Kết quả cho thấy tất cả các chủng vi khuẩn kiểm tra (74/74 chủng) đều khuếch đại được gen aerolysin đặc hiệu của vi khuẩn A. hydrophila với vạch ADN xuất hiện ở kích thước 209 bp (Hình 4.6). Kết quả này phù hợp với nghiên cứu của Pollard et al. (1990). Bên cạnh đó, kết quả giải trình tự sản phẩm PCR và so sánh trên cơ sở dữ liệu NCBI cho thấy 12 chủng vi khuẩn được chọn giải trình tự trong nghiên cứu (Phụ lục K2) có tỷ lệ tương đồng cao từ 98-99% (giá trị kỳ vọng rất thấp) với các chủng vi khuẩn A. hydrophila trên ngân hàng GenBank gồm: A. hydrophila chủng ZC1 (FJ608555.1), A. hydrophila chủng AH14 (EU650663.1), A. hydrophila chủng YBH090730L (GU169708.1), A. hydrophila chủng wp3 (FJ608554.1), A. hydrophila chủng XS91-4-1 (DQ186611.1), A. hydrophila chủng BZ (EF450824.1), A. hydrophila chủng NNX7 (JX502748.1), A. hydrophila chủng AH119SB-W30 (EU159682.1) và A. hydrophila chủng AH75SB-W43 (EU159683.1). Hình 4.6: Phổ điện di ADN của các chủng vi khuẩn A. hydrophila phân lập được bằng kỹ thuật PCR. M: thang chuẩn 100 bp và 100 bp plus; giếng 1: đối chứng âm; giếng 2-15: các chủng vi khuẩn A. hydrophila được kiểm tra theo thứ tự là 1A3, 2A3, 3A3, 4A3, 5A3, 6A3, 7A3, 8A3, 9A3, 10A3, 11A3, 12A3, 13A3, 14A3; giếng 17-25 và 27-32 thứ tự các mẫu là 15A5, 16A3, 17A3, 18A3, 19A3, 20A3, 21A3, 22A3, 23A3, 24A3, 25A3, 26A3, 27A3, 28A3, 29A3; giếng 16, 26 là các mẫu âm tính. Cho đến nay, việc sử dụng kỹ thuật PCR khuếch đại gen aerolysin của vi khuẩn A. hydrophila gây bệnh trên các loài cá hoặc trong môi trường nước đã được nhiều tác giả trong và ngoài nước thực hiện (Pollard et al., 1990; Singh et al., 2008; Umesha et al., 2011; Trần Nguyễn Diễm Tú và Đặng Thị Hoàng Oanh 2012; Lê Hữu Thôi và ctv., 2010). Sử dụng kỹ thuật mPCR, Panangala et al. (2007) đã phát hiện đồng thời vi khuẩn A. hydrophila cùng với vi khuẩn E. ictaluri và F. columnare gây bệnh trên cá nheo Mỹ. Nguyễn Hà Giang và ctv. (2010) cũng đã nghiên cứu thành công quy trình PCR chẩn đoán vi khuẩn A. hydrophila từ thận cá tra bệnh XH với độ nhạy và tính đặc hiệu tương đối cao. M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 M 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 209 bp71 4.1.3 Kết quả phân lập và định danh vi khuẩn E. coli Từ mẫu nước ao nuôi (n=10) và từ mẫu cá tra bệnh (n=10), đề tài đã phân lập được 30 chủng vi khuẩn E. coli (Phụ lục J3A) trên môi trường MKC. Do vi khuẩn E. coli trong nghiên cứu này chỉ sử dụng trong các thí nghiệm tiếp hợp với vi khuẩn A. hydophila và E. ictaluri (mục 3.3.6.4a) nên phần này chỉ trình bày tóm tắt kết quả phân lập, định danh và kết quả thực hiện kháng sinh đồ (kết quả chi tiết được trình bày ở Phụ lục J3A). Nhìn chung, khuẩn lạc vi khuẩn E. coli phát triển trên môi trường MKC có màu tím đặc trưng (Hình 4.7A) sau 18-24 giờ ủ ở 37oC (đường kính dao động từ 1-2 mm). Phần lớn khuẩn lạc có dạng tròn, bìa nguyên và độ nổi mô (1 số ít có độ nổi hơi lài). Kết quả nhuộm Gram (n=10) và chụp SEM (n=2) cho thấy vi khuẩn thuộc nhóm Gram âm, hình que ngắn (Hình 4.7B&C). Tất cả chủng vi khuẩn phân lập được đều cho phản ứng oxidase âm tính, catalase dương tính, có khả năng oxid hóa và lên men đường glucose trong cả 2 điều kiện hiếu khí và yếm khí (Hình 4.7D). Ngoài ra, tất cả các chủng vi khuẩn E. coli phân lập được trong nghiên cứu đều có khả năng di động. Bên cạnh đó, nghiên cứu sử dụng bộ kít API 20E (Hình 4.7E) để định danh 2 chủng vi khuẩn E. coli ECR2 và ECR4 (do đây là 2 chủng có kiểu hình nhạy với tất cả 15 kháng sinh được chọn trong thí nghiệm tiếp hợp). Kết quả từ Hình 4.7E cho thấy các chủng vi khuẩn E. coli cho phản ứng dương tính với orthonitrophenyl galactosidase, arginine, lysine, ornithine, citrate, tryptophane deaminase, indole, Voges-Proskauer, mannitol, sorbitol, rhamnose, melibiose và arabinose. Vi khuẩn cho phản ứng âm tính với H2S, urease, gelatin, glucose, inositol, saccharose và amygdalin. Như vậy, các chủng vi khuẩn phân lập được có các đặc điểm về hình thái khuẩn lạc, sinh lý và sinh hóa tương tự với vi khuẩn E. coli trong mô tả của các tác giả Zinnah et al. (2007), Soliman et al. (2010) và Chakravarty et al. (2015). Kết quả kiểm tra 1 số đặc điểm hình thái, sinh lý, sinh hóa và định danh vi khuẩn khác bằng bộ kít API 20E được trình bày ở Phụ lục J3B. Ngoài ra, kết quả thực hiện kháng sinh đồ cho thấy nhiều chủng vi khuẩn E. coli cũng đã kháng với nhiều loại kháng sinh (Phụ lục J3A), trong đó có 2 chủng ECR2 và ECR4 có kiểu hình nhạy với tất cả 15 kháng sinh (Phụ lục J3A) được chọn để sử dụng trong thí nghiệm tiếp hợp (nội dung này được đề cập ở mục 4.8).72 ONPG ADH LDC ODC CIT H2S URE TDA IND VP + + + + + - - + + + GEL GLU MAN INO SOR RHA SAC MEL AMY ARA - - + - + + - + - + Hình 4.7: Các đặc điểm hình thái, sinh lý và sinh hóa của vi khuẩn E. coli phân lập được từ ruột và nước ao nuôi cá tra ở Đồng Tháp. A. Khuẩn lạc vi khuẩn E. coli (chủng ECR2) sau 24 giờ ủ ở 37oC. B. Ảnh nhuộm Gram vi khuẩn (100X). C. Ảnh chụp dưới kính hiển vi điện tử quét (độ phóng đại 2.700X). D. Phản ứng oxid hóa và lên men đường glucose. E. Kết quả định danh chủng vi khuẩn E. coli ECR2 bằng bộ kít API 20E. 4.2 Kết quả cảm nhiễm cá tra với vi khuẩn E. ictaluri và A. hydrophila 4.2.1 Kết quả cảm nhiễm cá tra với các chủng vi khuẩn E. ictaluri 4.2.1.1 Kết quả tái phân lập và định danh vi khuẩn Cá lờ đờ hoặc vừa mới chết được sử dụng để tái phân lập và định danh vi khuẩn E. ictaluri sau khi cảm nhiễm. Kết quả cho thấy các chủng vi khuẩn E. ictaluri sau khi cảm nhiễm đều được phân lập từ các cơ quan như gan, thận và tỳ A B C D E73 tạng của cá bệnh. Kết quả kiểm tra các đặc điểm về hình thái, sinh lý và sinh hóa của vi khuẩn phân lập được từ cá bệnh sau khi cảm nhiễm hoàn toàn giống với các đặc điểm của chủng vi khuẩn trước khi tiến hành thí nghiệm, cụ thể khuẩn lạc vi khuẩn đều có màu trắng đục, nhỏ li ti khi cấy lên môi trường TSA sau 36-48 giờ (Hình 4.8A). Vi khuẩn có hình que dài, Gram âm (Hình 4.8B), di động yếu, cho phản ứng oxidase âm tính và catalase dương tính. Kết quả định danh lại bằng bộ kít API 20E (Hình 4.8C) cũng cho thấy 4 chủng vi khuẩn E. ictaluri sau khi gây cảm nhiễm đều cho phản ứng âm tính với các chỉ tiêu: orthonitrophenyl galactosidase, arginine, ornithine, citrate, H2S, urease, tryptophane deaminase, indole, gelatin, mannitol, inositol, sorbitol, rhamnose, saccharose, melibiose, amygdalin và arabinose; phản ứng dương tính với lysine, Voges-Proskauer và glucose. Bên cạnh đó, ADN được ly trích từ 1 số mẫu gan, thận và mẫu vi khuẩn sau khi tái phân lập của cá sau cảm nhiễm cũng cho kết quả dương tính với vạch ADN xuất hiện ở vị trí 470 bp (Hình 4.8D) khi được kiểm tra bằng kỹ thuật PCR. Như vậy, các kết quả cảm nhiễm trên đã thỏa mãn định đề Koch (Koch’s postulates). Hình 4.8: Kết quả tái phân lập và định danh vi khuẩn E. ictaluri sau khi cảm nhiễm trên cá tra. A. Khuẩn lạc vi khuẩn E. ictaluri (chủng 8ED3) phát triển trên môi trường TSA sau 48 giờ. B. Ảnh nhuộm Gram (100X) vi khuẩn E. ictaluri (chủng 8ED3). C. Kết quả tái định danh vi khuẩn bằng bộ kít API 20E. D. Kết quả tái định danh vi khuẩn bằng kỹ thuật PCR (M: thang chuẩn 100 bp plus; giếng 1: mẫu mô thận cá ở NT đối chứng; các giếng 2, 3, 4 và 5: mẫu ADN trích từ vi khuẩn và giếng 6, 7: mẫu ADN được trích từ thận và gan cá bệnh). M 1 2 3 4 5 6 7 470 bp C D A B74 4.2.1.2 Dấu hiệu bệnh lý của cá bệnh Quan sát thí nghiệm cho thấy cá tra ở 2 NT đối chứng (tiêm và không tiêm nước muối sinh lý) vẫn hoạt động bình thường, không có cá chết trong suốt quá trình thí nghiệm. Cá không có dấu hiệu nhiễm bệnh bệnh GTM khi quan sát bên ngoài và bên trong cơ thể (Hình 4.9A&B), đặc biệt là không phát hiện vi khuẩn phát triển khi cấy trên môi trường phân lập. Tuy nhiên, cá ở các NT cảm nhiễm vi khuẩn E. ictaluri thường có hiện tượng bơi lờ đờ và xoay tròn trước khi chết (Dung et al., 2012). Tất cả cá bệnh ở các NT thí nghiệm đều có các dấu hiệu bệnh lý bên ngoài và bên trong giống nhau. Các dấu hiệu đặc trưng của bệnh GTM gồm các đốm trắng nhỏ li ti xuất hiện trên gan, thận và tỳ tạng (Hình 4.9D). Trường hợp bệnh nặng, nội tạng của 1 số cá bệnh có hiện tượng trương phồng, nhũn và có dịch trong xoang bụng (Hình 4.9D). Tuy nhiên, cá chết ở thời gian đầu (thường ở ngày 2 và 3) sau khi cảm nhiễm thì các đốm trắng xuất hiện trên các cơ quan nội tạng của cá chưa được rõ (thường xuất hiện trên thận và tỳ tạng). Ngoài ra, qua thí nghiệm cảm nhiễm còn cho thấy các dấu hiệu biểu hiện bệnh bên ngoài của hầu hết cá cảm nhiễm thì không khác biệt so với cá ở NT đối chứng (Hình 4.9C), ngoại trừ 1 số cá bệnh có màu sắc hơi nhợt nhạt và xuất hiện các điểm xuất huyết trên các vây và xung quanh hậu môn. Như vậy, các dấu hiệu bệnh lý của cá tra sau khi cảm nhiễm vi khuẩn E. ictaluri tượng tự như mô tả của Ferguson et al. (2001), Từ Thanh Dung và ctv. (2004), Đặng Thị Hoàng Oanh và Nguyễn Thanh Phương (2009), Yuasa et al. (2003), Crumlish et al. (2010) và Dung et al. (2012). Tuy nhiên, các dấu hiệu biểu hiện bệnh bên ngoài của cá tra sau khi nhiễm vi khuẩn E. ictaluri trong nghiên cứu này không giống với các biểu hiện trên cá nheo Mỹ. Cụ thể, cá tra bệnh GTM thường có da và mang hơi nhợt so với cá khỏe (ngoại trừ 1 số ít trường hợp cá bệnh nặng thì mới xuất hiện xuất huyết ở trên các vây và xung quanh hậu môn) (Dung et al., 2012), cá không có các đốm xuất huyết xuất hiện rõ ràng như trên cá nheo Mỹ (Jacrboe et al., 1984; Hawke et al., 1998). Một điểm khác biệt nữa là trên các nội quan như gan, thận và tỳ tạng của cá tra bệnh GTM luôn xuất hiện các đốm trắng nhỏ li ti (Ferguson et al., 2001); Crumlish et al., 2010; Dung et al., 2012), trong khi các cơ quan này trên cá nheo Mỹ bệnh ESC thì không được ghi nhận mà thay vào đó là các dấu hiệu thường gặp như bụng phình to, chứa nhiều dịch do gan, thận và tỳ tạng trương phồng, sung huyết và xuất huyết ruột (Jacrboe et al., 1984; Blazer et al., 1985; Miyazaki and Plumb, 1985).75 Hình 4.9: Dấu hiệu biểu hiện bệnh GTM của cá tra cảm nhiễm với vi khuẩn E. ictaluri chủng 1ED3. A&B. Cá tra ở NT đối chứng (tiêm nước muối sinh lý). C. Biểu hiện bên ngoài của cá tra cảm nhiễm với chủng 1ED3. D. Dấu hiệu bên trong của cá tra cảm nhiễm với chủng 1ED3: cá bệnh GTM với các đốm trắng nhỏ li ti trên gan, thận và tỳ tạng (mũi tên). 4.2.1.3 Độc lực và khả năng gây bệnh của các chủng vi khuẩn E. ictaluri Độc lực và khả năng gây bệnh của vi khuẩn E. ictaluri được xác định qua thí nghiệm cảm nhiễm trên cá tra giống với 4 chủng: 1ED3, 3ED3, 8ED3 và 10ED3 ở 5 mật số tiêm vi khuẩn là 102, 103, 104, 105 và 106 CFU/cá. Qua kết quả thí nghiệm cho thấy các chủng vi khuẩn E. ictaluri khác nhau đều gây chết cá ở ngày thứ 2 sau khi cảm nhiễm, sau đó cá chết tập trung ở ngày thứ 3 đến ngày thứ 7 (thường chết cao nhất ở ngày 4-5), cá ngừng chết ở ngày thứ 10 cho đến khi kết thúc thí nghiệm (Hình 4.10). Trong khi đó, ở NT đối chứng (tiêm và không tiêm nước muối sinh lý) thì không có cá nào chết trong suốt thời gian theo dõi thí nghiệm. Kết quả phân tích cho thấy tỷ lệ cá chết tích lũy ở các nồng độ tiêm vi khuẩn khác biệt có ý nghĩa thống kê ở mức ý nghĩa 5% (P<0,05). Thời gian và tỷ lệ cá chết tích lũy của các chủng vi khuẩn được trình bày chi tiết ở Phụ lục L1. Ngoài ra, kết quả thí nghiệm cũng cho thấy tất cả các chủng vi khuẩn đều gây chết cá với tỷ lệ cao (trên 80%), trong đó chủng 1ED3 gây chết cá ở tỷ lệ cao nhất (96,67%), kế đến là 2 chủng 8ED3 và 10ED3 với cùng tỷ lệ gây chết là 90% và cá chết thấp nhất ở chủng 3ED3 (83,33%). Như vậy, qua các thí nghiệm của nghiên cứu này cho thấy vi khuẩn E. ictaluri khác nhau sẽ có thời gian và tỷ lệ cá chết khác nhau trên các loài cá khác nhau khi gây cảm nhiễm với chúng. Thí nghiệm của Plumb and Sanchez (1983) cho thấy cá nheo chết 100% trong 10 A D C B76 ngày sau khi cảm nhiễm với vi khuẩn E. ictaluri ở mật số vi khuẩn là 1,5x103 CFU/mL. Baxa et al. (1990) gây cảm nhiễm vi khuẩn E. ictaluri với các loài cá khác nhau bằng phương pháp ngâm ở nồng độ 1x108 CFU/mL. Kết quả sau 14 ngày thí nghiệm cho thấy vi khuẩn đã gây chết cá nheo với tỷ lệ là 32%, cá hồi trắng là 75% và cá vược sọc là 5% nhưng vi khuẩn không gây chết ở cá tầm trắng. Tương tự, cá nheo khi ngâm với vi khuẩn E. ictaluri ở mật độ 1x 107 CFU/mL trong thời gian 1 giờ cho thấy sau 5-20 ngày thí nghiệm, cá bị chết với tỷ lệ là 28% (Klesius and Sealey, 1995). Gần đây, Crumlish et al. (2010) tiến hành cảm nhiễm trên cá tra bằng phương pháp tiêm và ngâm với vi khuẩn E. ictaluri ở nồng độ vi khuẩn lần lượt là 1x106 và 1x108 CFU/mL. Kết quả cho thấy sau 12 ngày thí nghiệm tỷ lệ cá chết ở phương pháp tiêm là 95%, còn ở phương pháp ngâm là 80%. Hình 4.10: Tỷ lệ (%) cá tra chết tích lũy theo thời gian cảm nhiễm của 4 chủng vi khuẩn E. ictaluri. Như vậy, qua kết quả thí nghiệm cảm nhiễm cho thấy cả 4 chủng vi khuẩn E. ictaluri được chọn đều có độc lực và khả năng gây bệnh trên cá tra. Đề tài đã xác định được giá trị LD50 của 4 chủng vi khuẩn E. ictaluri 1ED3, 3ED3, 8ED3 và 10ED3 lần lượt là 1,67x104, 1,23x105, 1,58x104 và 1,19x105 CFU/mL (Bảng 4.5), trong đó chủng 1ED3 có độc lực cao nhất (LD50 = 1,58x104 CFU/mL), kế đến Chủng 1ED313,332033,3336,6736,6743,3373,3376,679096,67010203040506070809010024487296120144168192216240264288312336Thời gian cảm nhiễm (giờ)Tỉ lệ (%) cá chết tích lũy10^2 CFU/mL10^3 CFU/mL10^4 CFU/mL10^5 CFU/mL10^6 CFU/mLĐC NaCl 0,85%ĐC Chủng 3ED316,6723,3326,6733,3333,334043,3346,6776,6783,33010203040506070809010024487296120144168192216240264288312336Thời gian cảm nhiễm (giờ)Tỉ lệ (%) cá chết tích lũy10^2 CFU/mL10^3 CFU/mL10^4 CFU/mL10^5 CFU/mL10^6 CFU/mLĐC NaCl 0,85%ĐC Chủng 8ED33,336,6723,3326,674043,336073,3386,6790010203040506070809010024487296120144168192216240264288312336Thời gian cảm nhiễm (giờ)Tỉ lệ (%) cá chết tích lũy10^2 CFU/mL10^3 CFU/mL10^4 CFU/mL10^5 CFU/mL10^6 CFU/mLĐC NaCl 0,85%ĐC Chủng 10ED32026,673033,3333,334043,3346,6786,6790010203040506070809010024487296120144168192216240264288312336Thời gian cảm nhiễm (giờ)Tỉ lệ (%) cá chết tích lũy10^2 CFU/mL10^3 CFU/mL10^4 CFU/mL10^5 CFU/mL10^6 CFU/mLĐC NaCl 0,85%ĐC77 là chủng 8ED3 (LD50 = 1,67x104 CFU/mL) và thấp nhất là chủng 3ED3 (LD50 = 1,23x105 CFU/mL). Bảng 4.5: Giá trị LD50 của các chủng E. ictaluri cảm nhiễm trên cá tra Chủng vi khuẩn Mật độ tiêm vi khuẩn (CFU/mL) Tỷ lệ (%) cá chết tích lũy LD50 (CFU/mL) 1ED3* 102, 103, 104, 105, 106 20; 36,67; 43,33; 76,67; 96,67 1,58x104 3ED3 102, 103, 104, 105, 106 23,33; 33,33; 40; 46,67; 83,33 1,23x105 8ED3 102, 103, 104, 105, 106 6,67; 26,67; 43,33; 73,33; 90 1,67x104 10ED3 102, 103, 104, 105, 106 26,67; 33,33; 40; 46,67; 90 1,19x105 Chủng vi khuẩn có đánh * là chủng được chọn gây cảm nhiễm kép trên cá tra. Khả năng gây bệnh và độc lực của vi khuẩn E. ictaluri đã được nhiều tác giả trên thế giới nghiên cứu (Petrie-Hanson et al., 2007; Sakai et al., 2008; Ye et al., 2009; Suanyuk et al., 2014). Nhìn chung, hầu hết các nghiên cứu trước đây và trong nghiên cứu này đều cho thấy các chủng vi khuẩn khác nhau sẽ có khả năng gây bệnh và độc lực gây bệnh khác nhau trên các loài cá. Thí nghiệm của Plumb and Hilge (1987) trên cá da trơn Châu Âu (Silurus glanis) cho thấy ở mật độ tiêm 2.27×105 CFU/cá đã gây chết 100% cá thí nghiệm và đã xác định giá trị LD50 là 7,1 x 104 CFU/cá. Trong khi đó, nghiên cứu của Ye et al. (2009) cho thấy chủng vi khuẩn E. ictaluri LH51 đã gây chết 100% cá cá bò đen khi ngâm và tiêm với mật số vi khuẩn lần lượt là 1,2 x 106 CFU/mL và 2,0×105 CFU/cá. Nghiên cứu về độc lực của vi khuẩn E. ictaluri gây bệnh trên cá tra ở ĐBSCL của Đặng Thị Hoàng Oanh và Nguyễn Thanh Phương (2009) cho thấy các chủng vi khuẩn thí nghiệm có độc lực cao nhất là <102 CFU/mL và thấp nhất là 106 CFU/mL. Tuy nhiên, trong nghiên cứu này đã xác định chủng E. ictaluri có độc lực cao nhất là 103 CFU/mL và thấp nhất là 104 CFU/mL. Kết quả này cho thấy vi khuẩn trong thí nghiệm có độc lực rất cao (gây chết cá trên 80%) so với các nghiên cứu trước đây. Thí nghiệm cảm nhiễm vi khuẩn E. ictaluri trên cá tra của Đặng Thuỵ Mai Thy và Đặng Thị Hoàng Oanh (2010) cũng cho thấy chủng E. ictaluri Ei1 gây chết cá với tỷ lệ cao nhất (100%) ở mật số <102 CFU/mL, trong khi đó chủng E. ictaluri Ei4 ở mật số 6,4x105 CFU/mL gây chết với tỷ lệ thấp nhất (53%). Kết quả nghiên cứu của Liu et al. (2010) ở Trung Quốc cho thấy chủng vi khuẩn E. ictaluri HSN-1 có thể gây chết 100% cá thí nghiệm, trong khi chủng HAS-1 thì chỉ gây chết cá cao nhất là 62,5%. Ngoài ra, kết quả của thí nghiệm này cũng đã xác định chủng E. ictaluri HAS-1 có giá trị LD50 là 0,2x 104,7 CFU/mL. Trong khi đó, nghiên cứu của Geng and Wang (2013) cho thấy 2 chủng vi khuẩn E. ictaluri LW101 và LW102 đều có độc lực gây bệnh trên cá Silurus soldatovi meridionalis ở Trung Quốc. Tỷ lệ các chết tích lũy đối với chủng LW101 là78 100%, 95%, 60%, và 15% tương ứng với nồng độ tiêm vi khuẩn lần lượt là 1,0 x 107; 1,0 x 106; 1,0 x 105 và 1,0 x 104 CFU/cá, đối với chủng LW102 thì tỷ lệ cá chết tích lũy lần lượt là 100%, 100%, 65% và 10%. Ngoài ra, thí nghiệm cảm nhiễm bằng phương pháp tiêm và ngâm của Suanyuk et al. (2014) trên oài cá da trơn lai giữa 2 loài Clarias macrocephalus (Gunther) và Clarias gariepinus (Burchell) ở Thái Lan với vi khuẩn E. ictaluri cho thấy vi khuẩn gây chết cá với tỷ lệ dao động từ 23% đến 100% sau 14 ngày cảm nhiễm. Kết quả thí nghiệm này cũng đã xác định độc lực của vi khuẩn trong phương pháp ngâm ở 168 giờ với giá trị LD50 là 6,92 x 107 CFU/mL, đối với phương pháp tiêm ở 96 giờ là 1,58 x 106 CFU/cá. 4.2.2 Kết quả cảm nhiễm các chủng vi khuẩn A. hydrophila 4.2.2.1 Kết quả tái phân lập và định danh vi khuẩn Các chủng vi khuẩn được phân lập từ cá sau khi cảm nhiễm vi khuẩn A. hydrophila đều có màu vàng kem, tròn khi cấy lên môi trường TSA/GSP (Hình 4.11A&B). Bên cạnh đó, khi kiểm tra các đặc điểm về sinh lý và sinh hóa cho thấy vi khuẩn có hình que ngắn, Gram âm (Hình 4.11C), di động, cho phản ứng oxidase và catalase dương tính. Kết quả định danh lại bằng bộ kít API 20E (Hình 4.11D) cũng cho thấy 4 chủng vi khuẩn A. hydrophila tái phân lập từ cá bệnh sau khi gây cảm nhiễm đều cho phản ứng âm tính với các chỉ tiêu: ornithine, citrate, H2S, urease, tryptophane deaminase, indole, inositol, sorbitol, rhamnose, melibiose và arabinose; phản ứng dương tính với orthonitrophenyl galactosidase, arginine, lysine, Voges-Proskauer, gelatin, glucose, mannitol, saccharose và amygdalin. Bên cạnh đó, ADN được ly trích từ 1 số mẫu gan, thận và mẫu vi khuẩn sau khi tái phân lập vi khuẩn của cá sau cảm nhiễm cũng cho kết quả dương tính với vạch ADN xuất hiện ở vị trí 209 bp (Hình 4.11E) khi được kiểm tra bằng kỹ thuật PCR. Như vậy, các kết quả cảm nhiễm trên đã thỏa mãn định đề Koch (Koch’s postulates). 4.2.2.2 Dấu hiệu bệnh lý của cá bệnh Kết quả cảm nhiễm cho thấy tất cả cá bệnh ở các NT tiêm 4 chủng vi khuẩn A. hydrophila đều có dấu hiệu bệnh lý đặc trưng của bệnh XH (Hình 4.12C&D). Các dấu hiệu bên ngoài cá bệnh gồm mắt cá hơi lồi, trên da cá xuất hiện các đốm XH nhưng thường tập trung nhiều ở xung quanh miệng, mắt, ở các vây và hậu môn (Hình 4.12C). Đặc biệt, bên trong xoang bụng có dịch màu hồng (Hình 4.12D) và các cơ quan nội tạng cá bệnh như gan, thận và tỳ tạng thường có hiện tượng XH, phình to và nhũn. Trong khi đó, cá ở 2 NT đối chứng (tiêm và không tiêm nước muối sinh lý) thì vẫn hoạt động bình thường, cá không có dấu hiệu của bệnh XH khi quan sát bên ngoài và bên trong cơ thể, đặc biệt là không phát hiện79 vi khuẩn phát triển trên môi trường phân lập cũng như KST khi được kiểm tra (Hình 4.12A&B). Như vậy, các dấu hiệu bệnh lý của cá tra sau khi cảm nhiễm vi khuẩn A. hydrophila tượng tự như mô tả của Dung et al. (2008), Ly et al. (2009) và Crumlish et al. (2010). Kết quả cảm nhiễm vi khuẩn A. hydrophila trên cá nheo xanh/lục (blue catfish, Ictalurus furcatus) của Li et al. (2013) cũng có các dấu hiệu biểu hiện bệnh bên ngoài như xuất huyết và mắt lồi tương tự với vi khuẩn A. hydrophila cảm nhiễm trên cá tra trong nghiên cứu này. Hình 4.11: Kết quả tái phân lập và định danh vi khuẩn A. hydrophila. A&B. Khuẩn lạc vi khuẩn A. hydrophila phát triển trên môi trường TSA và GSP sau 24 giờ. C. Ảnh nhuộm Gram vi khuẩn (100X). D. Kết quả tái định danh vi khuẩn bằng bộ kít API 20E. E. Kết quả tái định danh vi khuẩn bằng kỹ thuật PCR (M: thang chuẩn 100 bp; giếng 1, 2 và 3: mẫu ADN trích từ vi khuẩn; giếng 4 và 5: mẫu ADN được trích từ thận và tỳ tạng cá bệnh; giến 6 và 7: mẫu mô thận và gan cá khỏe ở NT đối chứng). 4.2.2.3 Độc lực và khả năng gây bệnh của các chủng vi khuẩn A. hydrophila Tương tự, độc lực và khả năng gây bệnh của 4 chủng vi khuẩn A. hydrophila: 1A3, 2A3, 4A3 và 5A3 cũng được xác định qua thí nghiệm cảm nhiễm trên cá ở 5 mật độ tiêm vi khuẩn là 102, 103, 104, 105 và 106 CFU/cá. Kết quả thí nghiệm cho thấy tất cả các chủng vi khuẩn trong thí nghiệm đều có độc lực và khả năng gây bệnh cá với tỷ lệ chết rất cao (trên 90%), trong đó các chủng 1A3, 4A3 và 5A3 có tỷ lệ cá chết cao nhất (100%), thấp nhất là chủng 2A3 (93,33%). Kết quả phân tích cho thấy tỷ lệ cá chết tích lũy ở các nồng độ tiêm vi khuẩn khác biệt có ý nghĩa thống kê ở mức ý nghĩa 5% (P<0,05). Ngoài ra, qua kết quả thí nghiệm còn cho thấy các chủng vi khuẩn A. hydrophila đều gây chết cá rất sớm (6 giờ sau khi cảm nhiễm), cá chết tập trung ở thời điểm 24 đến 48 giờ A 209 bp E D B M 1 2 3 4 5 6 7 C80 sau khi cảm nhiễm (thường chết cao nhất ở thời điểm 24 giờ), cá ngừng chết ở thời gian 60-72 giờ cho đến khi kết thúc thí nghiệm (Hình 4.13). Thời gian và tỷ lệ cá chết tích lũy của các chủng vi khuẩn được trình bày chi tiết ở Phụ lục L2. Như vậy, qua các kết quả của nghiên cứu này cho thấy các chủng vi khuẩn A. hydrophila khác nhau sẽ có độc lực và thời gian gây bệnh khác nhau trên các loài cá khi chúng xâm nhiễm. Kết quả cảm nhiễm vi khuẩn A. hydrophila trên cá nheo Mỹ của Pridgeon and Klesius (2011) cho thấy 3 chủng vi khuẩn trong thí nghiệm cũng gây chết cá rất sớm (6 giờ) và cá chết nhiều ở thời điểm 24 giờ sau cảm nhiễm. Trong khi đó, ở NT đối chứng (tiêm và không tiêm nước muối sinh lý) thì không có cá nào chết trong suốt thời gian theo dõi thí nghiệm. Trong khi đó, kết quả cảm nhiễm vi khuẩn A. hydrophila trên cá nheo xanh của Li et al. (2013) cho thấy vi khuẩn gây chết cá sau 24 giờ. Hình 4.12: Dấu hiệu biểu hiện bệnh XH của cá tra cảm nhiễm với vi khuẩn A. hydrophila chủng 4A3. A&B. Cá tra ở NT đối chứng (tiêm nước muối sinh lý) với dấu hiệu bên ngoài và bên trong cơ thể bình thường. C. Cá tra cảm nhiễm với chủng 4A3: cá bệnh với dấu hiệu XH ở các vây, vùng mắt (mũi tên). D. Bên trong xoang cơ thể chứa nhiều chất dịch màu đỏ (mũi tên). A B C D81 Hình 4.13: Tỷ lệ (%) cá chết tích lũy theo thời gian của cá tra cảm nhiễm với các chủng vi khuẩn A. hydrophila. Tóm lại, qua kết quả thí nghiệm cảm nhiễm cho thấy các chủng vi khuẩn A. hydrophila được chọn có độc lực và khả năng gây bệnh trên cá tra. Qua kết quả của đề tài đã xác định được giá trị LD50 của 4 chủng vi khuẩn 1A3, 2A3, 4A3 và 5A3 lần lượt là 1,47x104, 2,37x103, 1,29x103 và 1,52 x104 CFU/mL (Bảng 4.6), trong đó chủng 4A3 có độc lực cao nhất (LD50 = 1,29x103 CFU/mL), kế đến là chủng 2A3 (LD50 = 2,37x103 CFU/mL) và thấp nhất là chủng 5A3 (LD50 = 1,52 x104 CFU/mL). Bảng 4.6: Giá trị LD50 của các chủng vi khuẩn A. hydrophila cảm nhiễm trên cá tra Chủng vi khuẩn Mật độ tiêm vi khuẩn (CFU/mL) Tỷ lệ (%) cá chết tích lũy LD50 (CFU/mL) 1A3 102, 103, 104, 105, 106 23,33; 30; 43,33; 83,33; 100 1,47x104 2A3 102, 103, 104, 105, 106 30; 40; 66,67; 83,33; 93,33 2,37x103 4A3* 102, 103, 104, 105, 106 33,33; 46,67; 76,67; 93,33; 100 1,29x103 5A3 102, 103, 104, 105, 106 26,67; 33,33; 43,33; 80; 100 1,52 x104 Chủng vi khuẩn có đánh * là chủng được chọn gây cảm nhiễm kết hợp trên cá tra. Cho đến nay, nhiều nghiên cứu về khả năng gây bệnh và độc lực của vi khuẩn A. hydrophila trên các loài cá trên thế giới đã được công bố (Azad et al., 2001; Rahman et al., 2001; Nusbaum and Morrison, 2002; Crumlish et al., 2010). Nhìn chung, giá trị độc lực và giá trị LD50 của 4 chủng vi khuẩn A. hydrpphila Chủng 1A313,3323,3326,67304043,3376,6783,3393,33100010203040506070809010061218243036424854607296120336Thời gian cảm nhiễm (giờ)Tỉ lệ (%) cá chết tích lũy10^2 CFU/mL10^3 CFU/mL10^4 CFU/mL10^5 CFU/mL10^6 CFU/mLĐC NaCl 0,85%ĐC Chủng 2A323,333026,674046,6766,6776,6783,3383,3393,33010203040506070809010061218243036424854607296120336Thời gian cảm nhiễm (giờ)Tỉ lệ (%) cá chết tích lũy10^2 CFU/mL10^3 CFU/mL10^4 CFU/mL10^5 CFU/mL10^6 CFU/mLĐC NaCl 0,85%ĐC Chủng 4A326,6733,334046,677076,6786,6793,3396,67100010203040506070809010061218243036424854607296120336Thời gian cảm nhiễm (giờ)Tỉ lệ (%) cá chết tích lũy10^2 CFU/mL10^3 CFU/mL10^4 CFU/mL10^5 CFU/mL10^6 CFU/mLĐC NaCl 0,85%ĐC Chủng 5A323,3326,6726,6733,3333,3343,3373,338096,67100010203040506070809010061218243036424854607296120336Thời gian cảm nhiễm (giờ)Tỉ lệ (%) cá chết tích lũy10^2 CFU/mL10^3 CFU/mL10^4 CFU/mL10^5 CFU/mL10^6 CFU/mLĐC NaCl 0,85%ĐC82 trong nghiên cứu này cao hơn các nghiên cứu đã được báo cáo. Thí nghiệm cảm nhiễm trên cá nheo Mỹ (Ictalurus punctatus) của Figueirredo and Plumb (1977) cho thấy các chủng vi khuẩn A. hydrophila phân lập từ cá bệnh có độc lực (giá trị LD50 là 6,4x104 CFU/mL) mạnh hơn các chủng A. hydrophila phân lập từ môi trường bên ngoài (LD50 là 1,5x108 CFU/mL). Tương tự, thí nghiệm trên cá chình (Anguilla anguilla) cũng thu được giá trị LD50 khá cao (105,4-107,2 CFU/mL) (Esteve et al., 1993). Ngoài ra, Sirirat et al. (1999) cũng đã xác định được độc lực của các chủng A. hydrophila khi cảm nhiễm trên cá trê giống với giá trị LD50 cao nhất là khoảng 105 CFU/mL sau 18 giờ cảm nhiễm. Báo cáo Pridgeon and Klesius (2011) cho thấy 3/4 chủng vi khuẩn A. hydrophila gây cảm nhiễm trên cá nheo Mỹ có độc lực tương đối cao, trong đó độc lực của chủng AL09-71 cao nhất với giá trị LD50 = 1,1 x 105 CFU/mL, kế đến là chủng AL09-73 (LD50 = 1,3 x 105 CFU/mL) và sau cùng là chủng AL09-72 (LD50 = 1,9 x 105 CFU/mL) nhưng các giá trị này nếu so với giá trị LD50 của 4 chủng vi khuẩn A. hydrophila trong nghiên cứu này thì vẫn thấp hơn. Bên cạnh đó, các chủng vi khuẩn A. hydrophila trong nghiên cứu này cũng có độc lực cao hơn các chủng vi khuẩn E. ictaluri khi cảm nhiễm trên cá tra. Kết quả này có thể là do vi khuẩn thuộc giống Aeromonas nói chung và vi khuẩn A. hydrophila nói riêng có nhiều gen độc lực khác nhau so với vi khuẩn E. ictaluri. Nhiều nghiên cứu đã xác định các gen độc lực ở vi khuẩn Aeromonas mã hóa cho các protein gây độc như haemolysin, aerolysin, serine protease, enterotoxins (gồm các gen hlyA, aerA, ahpA, alt và ast) (Chacon et al., 2002; Aguilera-Arreola et al., 2003; Nawaz et al., 2010; Sharma and Kumar, 2012). và các chủng vi khuẩn Aeromonas có những gen trên được chứng minh là những chủng có độc lực cao (Biscardi et al., 2002; Sha et al., 2002; Zhu et al., 2006; Li et al., 2011; Zheng et al., 2012; Oliveira et al., 2012). Ngoài ra, độc lực của vi khuẩn Aeromonas còn liên quan đến các plasmid (Borrego et al., 1991; Hanes et al., 1993; Vadivelu et al., 1995). Kết quả nghiên cứu của Majumdar et al. (2007) cho thấy plasmid của vi khuẩn A. hydrophila khi bị xử lý (làm mất đi plasmid bằng ethidium bromide ở nồng độ 30 µg/mL) đã làm cho vi khuẩn không thể gây bệnh UDS (ulcerative disease syndrome) trên cá trê trắng (C. Batrachus) ở Ấn Độ. Trong khi đó, ở vi khuẩn E. ictaluri thì cho đến nay các nghiên cứu về gen độc lực của vi khuẩn này vẫn còn hạn chế. Nghiên cứu của William and Lawrence (2005) đã xác định 2 gen hemolysin eihA và eihB của vi khuẩn E. ictaluri. Trong các nghiên cứu của Waltman et al. (1985) và Stanley et al. (1994) đã chứng minh chủng vi khuẩn có enzyme chondroitinase (enzyme này có chức năng phân hủy chondroitin sulfate, thành phần chính trong sụn) sẽ có độc lực mạnh hơn các chủng vi khuẩn không có83 hoạt tính chondroitinase. Ngoài ra, các nhân tố khác liên quan độc lực vi khuẩn E. ictaluri cũng đã được báo cáo như các chuỗi O-polysaccharide (Lawrence et al., 2001&2003), hoạt tính urease (Booth et al., 2006), hệ thống TTSS (type III secretion systems) (Thune et al., 2007). Trong nghiên này, ngoài gen aerolysin được xác định ở vi khuẩn A. hydrophila và gen bám dính ở vi khuẩn E. ictaluri thì các gen độc lực trên ở 2 loài vi khuẩn này không được thực hiện. Do đó, các nghiên cứu tiếp theo cần được thực hiện để xác định các gen độc lực và vai trò của plasmid liên quan đến quá trình gây bệnh của 2 loài vi khuẩn E. ictaluri và A. hydrophila nhằm làm sáng tỏ vấn đề trên. 4.3 Đặc điểm bệnh học cảm nhiễm kép 2 loài vi khuẩn A. hydrophila và E. ictaluri trên cá tra 4.3.1 Kết quả tái phân lập và định danh vi khuẩn Nhìn chung, tất cả cá có dấu hiệu biểu hiện kết hợp của bệnh GTM và XH sau khi nhiễm kép (Hình 4.14A) ở các NT đều phân lập được 2 loài vi khuẩn E. ictaluri và A. hydrophila trên môi trường TSA (Hình 4.14B và Bảng 4.7). Ngoài ra, cá có biểu hiện bệnh GTM hoặc XH ở phương pháp ngâm thì chỉ phân lập được hoặc vi khuẩn E. ictaluri hoặc A. hydrophila (Bảng 4.7). Trong khi đó, 1 số cá ở các NT tiêm có dấu hiệu bệnh GTM hoặc XH thì phân lập được cả 2 loại vi khuẩn trên, ngoại trừ 1 số cá bệnh GTM ở NT TK3 không phân lập được vi khuẩn A. hydrophila (Bảng 4.7) do vi khuẩn A. hydrophila tiêm sau vi khuẩn E. ictalluri. Cá chết ở 2 NT đối chứng thì không có dấu hiệu biểu hiện của bệnh GTM cũng như bệnh XH và cũng không phân lập được vi khuẩn. Bảng 4.7: Số lượng cá chết tích lũy và kết quả phân lập vi khuẩn trong thí nghiệm cảm nhiễm kép bằng phương pháp ngâm và tiêm NT Cá chết biểu hiện bệnh GTM Cá chết biểu hiện bệnh XH Cá chết biểu hiện bệnh GTM+XH Số cá E*. ictaluri A*. hydrophila Số cá A*. hydrophila E*. ictaluri Số cá E. ictaluri + A. hydrophila* NK3 4/28 4/4 0/4 9/28 9/9 0/9 15/28 15/15 TK1 1/25 1/1 0 16/25 16/16 5/16 8/25 8/8 TK2 3/24 3/3 2/3 9/24 9/9 3/9 12/24 12/12 TK3 4/26 4/4 0 5/26 5/5 1/5 17/26 17/17 TK4 8/28 8/8 1/8 3/28 3/3 2/3 17/28 17/17 TK5 7/29 7/7 2/6 1/29 1/1 1/1 21/29 21/21 * Kết quả tái phân lập vi khuẩn sau cảm nhiễm. NK3: Ngâm cá tra với chủng 1ED3 (106 CFU/mL) + chủng 4A3 (105 CFU/mL). TK1: Tiêm vi khuẩn A. hydrophila trước khi tiêm vi khuẩn E. ictaluri 12 giờ. TK2: Tiêm cùng lúc vi khuẩn A. hydrophila và E. ictaluri. TK3: Tiêm vi khuẩn A. hydrophila sau khi tiêm vi khuẩn E. ictaluri 24 giờ. TK4: Tiêm vi khuẩn A. hydrophila sau khi tiêm vi khuẩn E. ictaluri 48 giờ. TK5: Tiêm vi khuẩn A. hydrophila sau khi tiêm vi khuẩn E. ictaluri 72 giờ.84 Hai chủng vi khuẩn 1ED3 và 4A3 sau khi được phân lập và làm thuần từ cá tra nhiễm kép cũng được kiểm tra các đặc điểm về hình thái, sinh lý và sinh hóa theo các phương pháp sinh hóa và bằng bộ kít API 20E đã trình bày ở trên. Kết quả cho thấy 2 chủng vi khuẩn có đặc điểm hoàn toàn giống với chủng vi khuẩn được sử dụng để cảm nhiễm cá (kết quả kiểm tra không được trình bày lại trong phần này). Ngoài ra, 1 số mẫu mô gan/thận của cá nhiễm kép đều cho kết quả dương tính với 2 loài vi khuẩn khi được kiểm tra bằng kỹ thuật duplex-PCR với sự xuất hiện 2 vạch ADN ở kích thước 209 bp và 470 bp (Hình 4.14C). 4.3.2 Dấu hiệu bệnh lý của cá bệnh 4.3.2.1 Dấu hiệu bên ngoài Cá bệnh sau khi cảm nhiễm kép 2 chủng vi khuẩn A. hydrophila (4A3) và E. ictaluri (1ED3) bằng phương pháp ngâm và tiêm có các dấu hiệu chung như cá sắp chết nổi lờ đờ trên mặt nước; nhào lộn và xoay tròn, ngửa bụng, thả trôi theo dòng nước rồi chìm xuống đáy và cá chết thường có da hơi nhợt nhạt so với cá bình thường. Bên cạnh đó, mang cá bệnh đa số đều chuyển sang màu đỏ nhạt so với cá khỏe mạnh (màu đỏ đậm). Quan sát biểu hiện bên ngoài của cá bệnh do nhiễm kép thường có các dấu hiệu như mắt cá hơi lồi (Hình 4.15A); các vây thường có dấu hiệu XH (Hình 4.15A); XH bên ngoài cơ thể: các đốm XH xuất hiện rải rác trên cơ thể cá, tập trung ở vùng bụng, ở các vây, xung quanh hậu môn, miệng hoặc XH mắt, đặc biệt 1 số trường hợp hiện tượng XH xuất hiện khắp cơ thể của cá bệnh (Hình 4.15B). 4.3.2.2 Dấu hiệu bên trong Giải phẩu và quan sát nội quan cá sau khi cảm nhiễm kép ở 2 phương pháp ngâm và tiêm cho thấy xoang bụng của cá thường có chứa dịch lỏng màu hồng hay màu đỏ (Hình 4.16A). Ở giai đoạn đầu mới nhiễm bệnh thì những đốm trắng (do vi khuẩn E. ictaluri) chưa xuất hiện, xuất hiện chưa rõ hay chỉ xuất hiện trên thận hoặc tỳ tạng của cá. Các trường hợp cá bệnh nặng thì gan, thận và tỳ tạng cá bệnh thường phình to, mềm và nhũn (Hình 4.16A&B) và xuất hiện những đốm trắng (đường kính 1-2 mm) phân bố khắp ở các cơ quan này. Kết quả quan sát thí nghiệm ghi nhận đối với phương pháp ngâm thì hầu hết các dấu hiệu của cá nhiễm kép biểu hiện rõ hơn so với cá được cảm nhiễm bằng phương pháp tiêm nhưng nhìn chung cá bệnh ở 2 phương pháp ngâm và tiêm đều có dấu hiệu tương tự nhau.85 Hình 4.14: Kết quả tái phân lập và định danh 2 loài vi khuẩn A. hydrophila và E. ictaluri sau khi cảm nhiễm kết hợp trên cá tra. A. Cá tra nhiễm kép vi khuẩn E. ictaluri và A. hydrophila ở NT ngâm. B. Khuẩn lạc vi khuẩn E. ictaluri và A. hydrophila phân lập từ cá tra nhiễm kép phát triển trên môi trường TSA sau 48 giờ. C. Kết quả kiểm tra sự hiện diện của vi khuẩn E. ictaluri và A. hydrophila từ mô gan/thận cá nhiễm kép được phát hiện bằng kỹ thuật PCR (M: thang chuẩn 100 bp; giếng 1: mẫu mô cá đối chứng; giếng 2 và 3 mẫu thận cá bệnh XH và GTM; giếng 4, 5 và 6: mẫu thận cá nhiễm kép bằng phương pháp tiêm; giếng 7-22: kết quả kiểm tra mẫu mô thận/gan cá nhiễm kép ở phương pháp ngâm; giếng 11 và 14 mẫu mô thận cho kết quả âm tính). Hình 4.15: Các dấu hiệu bên ngoài của cá bệnh do nhiễm kép 2 chủng vi khuẩn A. hydrophila (4A3) và E. ictaluri (1ED3). A. XH xuất hiện trên rải rác trên thân, ở vùng đầu, mắt, các vây và hậu môn cá bệnh (cá ở NT tiêm vi khuẩn A. hydrophila sau 24 giờ tiêm E. ictaluri). B. Nhiều điểm XH xuất hiện khắp trên cơ thể cá (cá ở NT ngâm). B A 470 bp 209 bp A B C M 1 2 3 4 5 6 M 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 2286 Hình 4.16: Dấu hiệu bên trong cá cảm nhiễm kép 2 chủng vi khuẩn A. hydrophila (4A3) và E. ictaluri (1ED3). A. Gan, tỳ tạng phình to; thận bị nhũn và xong bụng chứa nhiều dịch màu hồng (mũi tên). B. Gan, thận và tỳ tạng nhũn, hoại tử và tiết nhiều chất dịch trong xoang bụng (mũi tên). 4.3.3 Khả năng gây bệnh khi gây cảm nhiễm kép 2 loài vi khuẩn 4.3.3.1 Kết quả cảm nhiễm bằng phương pháp ngâm Nhìn chung, qua kết quả thí nghiệm cho thấy việc kết hợp 2 loài vi khuẩn E. ictaluri và A. hydrophila đã gia tăng độc lực gây bệnh của vi khuẩn với thời gian bệnh xuất hiện sớm hơn so với phương pháp nhiễm đơn (Hình 4.17). Cụ thể, thời gian gây bệnh của NT nhiễm kép là 12 giờ, trong khi ở NT ngâm chủng 1ED3 và 4A3 thì thời gian vi khuẩn bắt đầu gây chết cá lần lượt là 96 giờ và 36 giờ. Bên cạnh đó, tỷ lệ cá chết tích lũy ở NT nhiễm kép cũng cao hơn (93,33%) so với 2 NT nhiễm đơn, đối với chủng 1ED3 là 66,67% và chủng 4A3 là 60% (Hình 4.17). Kết quả phân tích cho thấy tỷ lệ cá chết tích lũy ở các NT ngâm kép 2 loài vi A B87 khuẩn khác biệt có ý nghĩa thống kê ở mức ý nghĩa 5% (P<0,05) so với NT ngâm đơn (Phụ lục M). Ở NT đối chứng (cá ngâm nước muối sinh lý) đều có cá chết. Tuy nhiên, kết quả quan sát cho thấy cá chết không có dấu hiệu bệnh của 2 loài vi khuẩn và kết quả tái phân lập cũng không có vi khuẩn. Tỷ lệ cá chết tích lũy theo thời gian sau cảm nhiễm kết hợp 2 loài vi khuẩn A. hydrophila và E. ictaluri bằng phương pháp ngâm được trình bày chi tiết ở Phụ lục N. Hình 4.17: Tỷ lệ (%) cá chết tích lũy qua các ngày cảm nhiễm kết hợp 2 loài vi khuẩn E. ictaluri và A. hydrophila trên cá tra bằng phương pháp ngâm. NK1: Ngâm cá tra với chủng 1ED3 (106 CFU/mL). NK2: Ngâm cá tra với chủng 4A3 (105 CFU/mL). NK3: Ngâm cá tra với chủng 1ED3 (106 CFU/mL) + chủng 4A3 (105 CFU/mL). NK4: Đối chứng ngâm nước muối sinh lý NaCl 0,85%. NK5: Đối chứng không ngâm nước muối sinh lý NaCl 0,85%. 4.3.3.2 Kết quả cảm nhiễm bằng phương pháp tiêm Kết quả thí nghiệm cho thấy việc cảm nhiễm kép bằng phương pháp tiêm cũng làm tăng độc lực của vi khuẩn với tỷ lệ cá chết cao hơn so với phương pháp tiêm đơn (Hình 4.18). Qua kết quả ở Hình 4.18 cho thấy sau 7 ngày tiêm vi khuẩn thì cá cảm nhiễm ở 2 NT TK4 và TK5 có tỷ lệ cá chết tích lũy cao nhất lần lượt là 96,67% và 93,33%, kế đến là NT TK3 (86,67%) và TK1 (83,33%) và thấp nhất là NT TK2 (80%). Bên cạnh đó, kết quả của thí nghiệm còn cho thấy cá chết mạnh ở các NT sau khi tiêm vi khuẩn A. hydrophila, trong đó cá chết tập trung và nhiều nhất là từ ngày thứ 2 đến ngày thứ 5 (đặc biệt ở các NT tiêm vi khuẩn A. hydrophila sau khi tiêm E. ictaluri 48 và 72 giờ), sau đó cá chết giảm dần và từ ngày thứ 7 trở đi không thấy xuất hiện cá chết cho đến khi kết thúc thí nghiệm. Tuy nhiên, kết quả phân tích cho thấy tỷ lệ cá chết tích lũy giữa các NT khác biệt không có ý nghĩa thống kê (P>0,005) (Phụ lục O). Trong khi đó, cá ở 2 NT đối chứng tiêm và không tiêm nước muối sinh lý đều hoạt động bình thường cho đến 66,676093,333,33010203040506070809010061224364860728496108120132144156168180192216240264288312336Thời gian (giờ)% cá chết tích lũyNK1NK2NK3NK4NK588 khi kết thúc thí nghiệm, ngoại trừ có 1 cá chết ở NT tiêm nước muối sinh lý. Tuy nhiên, không phân lập được vi khuẩn từ cá chết và cá chết cũng không có các biểu hiện của bệnh GTM hoặc XH. Ngoài ra, các chỉ tiêu môi trường như nhiệt độ và pH không có sự thay đổi đáng kể. Như vậy, cá chết có thể do nguyên nhân khác. Tỷ lệ cá chết tích lũy theo thời gian sau khi cảm nhiễm kết hợp 2 loài vi khuẩn A. hydrophila và E. ictaluri bằng phương pháp tiêm được trình bày chi tiết trong Phụ lục P. Hình 4.18: Tỷ lệ cá (%) cá chết tích lũy qua các ngày cảm nhiễm kết hợp 2 loài vi khuẩn E. ictaluri và A. hydrophila trên cá tra bằng phương pháp tiêm. TK1: Tiêm vi khuẩn A. hydrophila trước khi tiêm vi khuẩn E. ictaluri 12 giờ. TK2: Tiêm cùng lúc vi khuẩn A. hydrophila và E. ictaluri. TK3: Tiêm vi khuẩn A. hydrophila sau khi tiêm vi khuẩn E. ictaluri 24 giờ. TK4: Tiêm vi khuẩn A. hydrophila sau khi tiêm vi khuẩn E. ictaluri 48 giờ. TK5: Tiêm vi khuẩn A. hydrophila sau khi tiêm vi khuẩn E. ictaluri 72 giờ. TK6: Đối chứng tiêm nước muối sinh lý NaCl 0,85%. TK7: Đối chứng không tiêm nước muối sinh lý NaCl 0,85%. TĐ4A3: Tiêm cá tra với chủng 4A3 ở mật số 103 CFU/cá. TĐ1ED3: Tiêm cá tra với chủng 1ED3 ở mật số 104 CFU/cá. Như vậy, qua các NT thí nghiệm trên cho thấy việc cảm nhiễm kép 2 loài vi khuẩn E. ictaluri và A. hydrophila đã làm tăng độc lực gây bệnh của 2 loài vi khuẩn so với phương pháp cảm nhiễm đơn. Điều này dẫn đến kết quả bệnh trên cá tra bộc phát mạnh và tỷ lệ cá chết cao. Đó là lý do giải thích tại sao cá ngoài ao nuôi tự nhiên lại chết nhanh và có tỷ lệ chết cao sau khi nhiễm cùng lúc 2 loài vi khuẩn này. Như vậy, tác dụng hiệp lực của 2 loài vi khuẩn nhiễm kép trong nghiên cứu này phù hợp với kết quả nghiên cứu trước đây của nhiều tác giả. Nghiên cứu của Dong et al. (2015) cho thấy tỷ lệ cá chết tích lũy ở NT ngâm hay tiêm kép 2 loài vi khuẩn F. columnare và E. ictaluri trên cá tra ở Thái Land cao hơn có ý nghĩa thống kê (P<0,05) so với NT ngâm/tiêm đơn F. columnare hay E. ictaluri. Ngoài ra, nhiều nghiên cứu khác còn cho thấy vi khuẩn A. hydrophila khi 3,3383,338086,6793,3396,6746,6743,33010203040506070809010061224364860728496108120132144156168336Thời gian (giờ)% cá chết tích lũyTK1TK2TK3TK4TK5TĐ4A3TĐ1ED3ĐC 0.85% NaClĐC89 cảm nhiễm kết hợp với các vi khuẩn khác sẽ làm tăng độc lực gây bệnh trên cá được cảm nhiễm. Kết quả nghiên cứu của Nusbaum and Morrison (2002) cho thấy cá nheo sẽ bộc phát bệnh mạnh và các dấu hiệu lâm sàng của bệnh do vi khuẩn E. ictaluri sẽ trở nên rõ ràng hơn khi có sự xuất hiện và hiện diện của vi khuẩn A. hydrophila. Nghiên cứu của Đặng Thụy Mai Thy và ctv. (2012) cũng cho thấy khi tiêm kết hợp 2 loài vi khuẩn A. hydrophila và Streptococcus sp. trên cá rô đồng thì tỷ lệ chết của cá sẽ tăng lên đáng kể (90%) so với NT tiêm riêng biệt từng chủng vi khuẩn (25% và 45%). Thí nghiệm gây cảm nhiễm kết hợp 2 loài vi khuẩn A. hydrophila và E. ictaluri bằng phương pháp ngâm và tiêm của Crumlish et al. (2010) trên cá tra cũng cho kết quả tương tự. Trong cả 2 phương pháp được thực hiện thì tỷ lệ cá chết ở NT chỉ tiêm A. hydrophila hoặc E. ictaluri luôn thấp hơn đáng kể so với NT tiêm kết hợp 2 loài vi khuẩn A. hydrophila và E. ictaluri. Trong quá trình thí nghiệm cảm nhiễm thì nhiệt độ và pH của nước được duy trì ổn định ở các thí nghiệm cảm nhiễm đơn (Phụ lục Q1) và cảm nhiễm kép (Phụ lục Q2). Nhìn chung, các giá trị này hầu như không có sự biến động lớn (nhiệt độ dao động trong khoảng 28±2oC và pH = 7,8±3). Điều này cho thấy các yếu tố của môi trường bên ngoài không ảnh hưởng đến sự thay đổi nhiệt độ và pH của môi trường nước nên có thể khẳng định cá chết ở các NT là do vi khuẩn cảm nhiễm gây ra. Mặt khác, ở nhiệt độ và pH của nước như trên là điều kiện thích hợp để vi khuẩn E. ictaluri và A. hydrophila sinh trưởng và phát triển nên làm tăng tỷ lệ chết của cá thí nghiệm. Theo Plumb and Vininantharat (1989) thì vi khuẩn E. ictaluri phát triển tốt ở nhiệt độ 28-30oC và pH là 7,0-7,5. Trong khi đó, vi khuẩn A. hydrophila thuộc nhóm vi khuẩn ưa nhiệt độ trung bình, có thể phát triển tốt ở nhiệt độ 37oC. Nhiều nghiên cứu cho thấy vi khuẩn A. hydrophila có thể phát triển tốt nhất ở nhiệt độ dao động từ 20-35oC (Popoff, 1984; Palumbo et al., 1985), trong khi giá trị pH không ảnh hưởng lên sự tăng trưởng của chúng (Sautour et al., 2003). Trong thí nghiệm cảm nhiễm xác định độc lực của vi khuẩn E. ictaluri và A. hydrophila, các chủng vi khuẩn A. hydrophila mặc dù có mật số vi khuẩn tiêm cho cá tra thấp hơn so với vi khuẩn E. ictaluri nhưng có thời gian gây bệnh trên cá tra sớm hơn (thường sau 6 giờ so với 24 giờ ở vi khuẩn E. ictaluri) và tỷ lệ gây chết cá cũng cao hơn (trung bình 81,9% so với 77,8% ở vi khuẩn E. ictaluri). Tuy nhiên, trong nghiên cứu của Crumlish et al. (2010) cho thấy tỷ lệ cá chết ở các NT tiêm vi khuẩn A. hydrophila (kể cả phương pháp ngâm vi khuẩn) lại thấp hơn so với các NT tiêm vi khuẩn E. ictaluri nhưng thời gian vi khuẩn A. hydrophila90 gây bệnh là ngày 2 so với ngày 4 ở vi khuẩn E. ictaluri. Như vậy, thời gian gây bệnh của vi khuẩn A. hydrophila sớm hơn vi khuẩn E. ictaluri do độc lực của chúng mạnh hơn vi khuẩn E. ictaluri. Trong các thí nghiệm cảm nhiễm kết hợp 2 loại vi khuẩn hoặc cảm nhiễm riêng từng loại vi khuẩn cho thấy cá tra cảm nhiễm nhân tạo có các dấu hiệu của bệnh gan thận mủ và bệnh xuất huyết giống với các đặc điểm cá nhiễm bệnh ngoài tự nhiên. Vì vậy, các kết quả của cảm nhiễm trong nghiên cứu này đã thỏa mãn định đề Koch. Nghiên cứu của Crumlish et al. (2010) cho thấy vi khuẩn E. ictaluri chỉ được phân lập từ cá ở các NT có tiêm vi khuẩn này, trong khi vi khuẩn A. hydrophila không chỉ thu được từ cá có tiếp xúc với vi khuẩn này mà còn phân lập được từ cá ở các NT chỉ tiêm vi khuẩn E. ictaluri. Kết quả tương tự cũng được báo cáo trong nghiên cứu của Nusbaum and Morrison (2002). Tuy nhiên, trong nghiên cứu này thì chỉ phân lập được vi khuẩn A. hydrophila từ cá được cảm nhiễm hay tiếp xúc với khuẩn này (gồm nhiễm đơn và nhiễm kết hợp) mà không thu được vi khuẩn từ các NT chỉ gây cảm nhiễm vi khuẩn E. ictaluri. Trong nghiên cứu này, việc tiêm cùng lúc 2 loài vi khuẩn trên cá tra đã làm cho cá có tỷ lệ chết thấp hơn so với các NT tiêm vi khuẩn A. hydrophila trước và sau khi tiêm vi khuẩn E. ictaluri. Điều này có thể là do sự cạnh tranh giữa vi khuẩn E. ictaluri và A. hydrophila nên chúng làm giảm độc lực của nhau. Còn ở các NT tiêm vi khuẩn A. hydrophila sau khi tiêm vi khuẩn E. ictaluri có tỷ lệ cá chết là do khi cá bị nhiễm một loại bệnh thì độc lực của bệnh đó sẽ tác động lên cá. Nhưng sau đó, cá này lại nhiễm tiếp tục 1 bệnh khác thì lúc này độc lực do vi khuẩn nhiễm trước và nhiễm sau sẽ đồng thời tác động lên cá làm cho cá chết cao. Mặt khác, vi khuẩn A. hydrophila là tác nhân cơ hội (Crumlish et al., 2010) thường gây bệnh khi vật chủ có hệ miễn dịch bị suy yếu hoặc bị stress (Roberts, 1993). Do đó, khi vi khuẩn E. ictaluri xâm nhiễm vào cá tra trước thì có thể chúng đã làm suy giảm 1 phần khả năng miễn dịch của cá tra, tạo điều kiện cho vi khuẩn A. hydrophila phát triển và làm bùng phát dịch bệnh. Nghiên cứu của Nusbaum and Morrison (2002); Crumlish et al. (2010); Đặng Thụy Mai Thy và ctv. (2012) cũng cho kết quả tương tự, khi có sự hiện diện của 2 loài vi khuẩn sẽ làm gia tăng độc lực gây bệnh của chúng lên vật chủ sẽ bộc phát và sẽ làm cho bệnh phát triển mạnh hơn. 4.3.4 Kết quả quan sát mẫu bằng phết kính tiêu bản tươi Quan sát mẫu phết kính tiêu bản tươi (nhuộm Wright-Giemsa) của cá bệnh ở các NT nhiễm kép cho thấy trên vùng mô phết kính đều xuất hiện 2 dạng vi khuẩn hình que: dạng que ngắn (A. hydrophila) và dạng que dài, mảnh (E.91 ictaluri) nằm rải rác hay tập trung thành từng cụm trên các vùng mô phết kính của các cơ quan như mang, gan thận, tỳ tạng và mô da-cơ (Hình 4.19B). Trong khi ở NT đối chứng thì không có vi khuẩn hiện diện trên vùng phết kính vào ngày thu mẫu cuối cùng (Hình 4.19A). Vi khuẩn thường xuất hiện nhiều ở các cơ quan gan, thận và tỳ tạng, trong khi mô da-cơ và mang thì vi khuẩn thường xuất hiện ít hơn. Đối với NT ngâm thì tất cả cá biểu hiện 2 bệnh đều xuất hiện cả 2 loài vi khuẩn trên vùng mô. Tuy nhiên, ở các mẫu chỉ biểu hiện bệnh GTM hoặc XH thì trên vùng mô thường cũng chỉ xuất hiện vi khuẩn E. ictaluri hoặc A. hydrophila. Trong khi đó, kết quả phết kính ở NT tiêm cho thấy ở NT tiêm vi khuẩn A. hydrophila trước thì trên vùng mô chỉ có vi khuẩn A. hydrophila, trong khi ở NT chưa tiêm vi khuẩn A. hydrophila thì mẫu cá phết kính chỉ có sự xuất hiện của vi khuẩn E. ictaluri, riêng NT tiêm cùng lúc 2 loài vi khuẩn E. ictaluri và A. hydrophila thì có cả 2 loài vi khuẩn E. ictaluri và A. hydrophila. Tuy nhiên, 1 số trường hợp cá ở các NT tiêm lại có hiện diện cả 2 loài vi khuẩn trên vùng mô mặc dù biểu hiện bệnh chỉ 1 trong 2 bệnh trên. Ngoài ra, ở thời gian ban đầu thí nghiệm thì vi khuẩn xuất hiện ít hơn ở thời gian càng về cuối thí nghiệm. Nhiều mẫu phết kính cho thấy vi khuẩn bao quanh tế bào hồng cầu (Hình 4.19C) và chúng tấn công phá vỡ màng tế bào hồng cầu (Hình 4.19D). Bên cạnh đó, quan sát trên mô thận phết kính cho thấy nhiều tế bào vi khuẩn bao quanh các tế bào bạch cầu (Hình 4.19E). Đặc biệt, hiện tượng thực bào vi khuẩn của các đại thực bào (Hình 4.19F) cũng tham gia vào hệ thống miễn dịch của cơ thể, chống lại các tác nhân gây bệnh. 4.3.5 Biến đổi cấu trúc mô của 1 số cơ quan cá bệnh 4.3.5.1 Biến đổi cấu trúc mô da-cơ Cấu trúc mô da-cơ cá tra gồm lớp biểu bì bên ngoài, kế đến là lớp tế bào hắc tố, lớp hạ bì và lớp cơ (Hình 4.20A). Da cá có chức năng bảo vệ cơ thể không bị tổn thương và là hàng rào vật lý ngăn chặn các tác nhân gây bệnh. Qua khảo sát mô da-cơ của cá bệnh khi gây cảm nhiễm kép 2 loài vi khuẩn E. ictaluri và A. hydrophila ở các NT cho thấy cấu trúc mô ít biến đổi so với mô cá khỏe mặc dù kết quả phết kính sau khi thu mẫu cá cảm nhiễm 2 loài vi khuẩn E. ictaluri và A. hydrophila nhuộm Giemsa cho thấy có 2 dạng vi khuẩn hình que ngắn và que dài hiện diện trên vùng mô da-cơ của cá bệnh. Các biến đổi trên mô da-cơ cá nhiễm kép thường là hiện tượng XH trên các bó cơ (Hình 4.20B). Ngoài ra, ở 1 số mẫu mô cá bệnh cũng có hiện tượng các bó cơ liên kết rời rạc (Hình 4.20C) và xuất hiện vùng cơ bị biến đổi cấu trúc và hoại tử (Hình 4.20D). Theo Hybiya (1982) thì mô da-cơ ít bị ảnh hưởng trực tiếp bởi vi khuẩn là do cấu trúc cơ quan này khá92 rắn chắc và không giữ vai trò quan trọng trong quá trình tạo máu và không trực tiếp tham gia vào hệ miễn dịch của cơ thể. Vì vậy, ít có khả năng tiếp xúc và ít bị tấn công bởi vi khuẩn. Hình 4.19: Các mẫu phết kính cá nhiễm kép 2 loài vi khuẩn E. ictaluri và A. hydrophila (Wright-Giemsa, 100X). A. Mẫu thận cá khỏe: a: hồng cầu, b: bạch cầu đơn nhân và c: tế bào lympho. B. Sự phân bố của vi khuẩn E. ictaluri và A. hydrophila trên mô tỳ tạng (100X) sau 12 giờ. C. Vi khuẩn E. ictaluri và A. hydrophila bao quanh hồng cầu ở thận cá tra (100X) sau 12 giờ ( a: vi khuẩn A. hydrophila, b: vi khuẩn E. ictaluri). D. Màng tế bào hồng cầu bị vi khuẩn phá vỡ (mũi tên) sau 24 giờ (100X). E. Các vi khuẩn bao quanh các bạch cầu trên mô thận (mũi tên) sau 48 giờ (100X). F. Đại thực bào vi khuẩn ở thận (mũi tên) sau 24 giờ (100X). E F C A B D a b c93 Hình 4.20: Đặc điểm mô da-cơ cá tra nhiễm kép (H&E). A. Da-cơ cá khỏe (20X), a: lớp biểu bì, b: lớp hạ bì, c: lớp cơ. B. Các bó cơ bị XH sau 96 giờ (20X). C. Cấu trúc các bó cơ rời rạc sau 120 giờ (20X). D. Vùng cơ bị biến đổi cấu trúc và hoại tử sau 120 giờ (20X). 4.3.5.2 Biến đổi cấu trúc mô mang Mang cá tra gồm 2 bộ nằm ở 2 bên đầu, mỗi bộ có 4 cung mang và mỗi cung mang có 2 lá mang. Lá mang có màu đỏ và được cấu tạo bởi nhiều sợi mang sơ cấp và trên sợi mang sơ cấp có nhiều sợi mang thứ cấp sắp xếp theo hình lông chim (Hình 4.21A). Qua khảo sát mô mang cá bệnh nhiễm kép 2 loài vi khuẩn E. ictaluri và A. hydrophila ở các NT của 2 phương pháp ngâm và tiêm cho thấy cấu trúc mô mang có những biến đổi như động mạch ra vào mang bị sung huyết và XH (Hình 4.21B); sợi mang sơ cấp và thứ cấp có hiện tượng sung huyết và XH, đặc biệt sự phình to và dính lại của nhiều sợi mang sơ cấp và thứ cấp (Hình 4.21C). Trong khi đó, ở NT đối chứng thì cấu trúc mang không có sự biến đổi trong thời gian theo dõi thí nghiệm. Hiện tượng sợi mang thứ cấp bị dính lại với nhau, sưng viêm và cấu trúc bị phá vỡ có thể là do khi vi khuẩn tấn công sẽ tạo nên phản ứng miễn dịch làm các tế bào ở mang sưng lên và khi các tế bào sưng càng to thì sẽ dẫn đến sự tiếp xúc a b c A B C D

- Xem thêm -

Tài liệu liên quan

Bình luận